Transcript: Mouse XM_006535620.3

PREDICTED: Mus musculus CD36 antigen (Cd36), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cd36 (12491)
Length:
2701
CDS:
300..1718

Additional Resources:

NCBI RefSeq record:
XM_006535620.3
NBCI Gene record:
Cd36 (12491)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535620.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066519 GCCATAATTGAGTCCTATAAA pLKO.1 972 CDS 100% 15.000 21.000 N Cd36 n/a
2 TRCN0000066522 GCCAAGCTATTGCGACATGAT pLKO.1 1016 CDS 100% 4.950 6.930 N Cd36 n/a
3 TRCN0000066520 CGGATCTGAAATCGACCTTAA pLKO.1 1136 CDS 100% 10.800 7.560 N Cd36 n/a
4 TRCN0000066521 GCAGGTCAACATATTGGTCAA pLKO.1 1460 CDS 100% 4.050 2.835 N Cd36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535620.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05961 pDONR223 100% 83.8% 84.1% None (many diffs) n/a
2 ccsbBroad304_05961 pLX_304 0% 83.8% 84.1% V5 (many diffs) n/a
3 TRCN0000469598 CAGGCTGCAAACGTATGCACATCT pLX_317 20.6% 83.8% 84.1% V5 (many diffs) n/a
4 TRCN0000491898 AACTTATCTTTGGCCATGTCCTCA pLX_317 20.6% 83.8% 84.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV