Transcript: Mouse XM_006535679.3

PREDICTED: Mus musculus DnaJ heat shock protein family (Hsp40) member C2 (Dnajc2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dnajc2 (22791)
Length:
2036
CDS:
331..1974

Additional Resources:

NCBI RefSeq record:
XM_006535679.3
NBCI Gene record:
Dnajc2 (22791)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535679.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008554 CGGGCATTTAACAGTGTAGAT pLKO.1 571 CDS 100% 4.950 6.930 N Dnajc2 n/a
2 TRCN0000365853 AGAAGATGATCTGCAATTATT pLKO_005 1473 CDS 100% 15.000 10.500 N Dnajc2 n/a
3 TRCN0000374114 ATGGGAAGTCATTGCTAATTA pLKO_005 1536 CDS 100% 15.000 10.500 N Dnajc2 n/a
4 TRCN0000374113 GAACTGCCAAAGATGTTATTA pLKO_005 1589 CDS 100% 15.000 10.500 N Dnajc2 n/a
5 TRCN0000254055 ACAGATCAAAGCAGCTCATAA pLKO_005 423 CDS 100% 13.200 9.240 N DNAJC2 n/a
6 TRCN0000374143 ACAGATCAAAGCAGCTCATAA pLKO_005 423 CDS 100% 13.200 9.240 N Dnajc2 n/a
7 TRCN0000365925 CAATGAGGCAGACCGTGTTAA pLKO_005 1212 CDS 100% 13.200 9.240 N Dnajc2 n/a
8 TRCN0000254057 TACTTCACTTGCATAACTAAA pLKO_005 517 CDS 100% 13.200 9.240 N DNAJC2 n/a
9 TRCN0000365966 TACTTCACTTGCATAACTAAA pLKO_005 517 CDS 100% 13.200 9.240 N Dnajc2 n/a
10 TRCN0000008553 CAACAGAAGAACAGAAACTTT pLKO.1 1772 CDS 100% 5.625 3.938 N Dnajc2 n/a
11 TRCN0000008556 CCCAAAGATTGGAAGAATCAA pLKO.1 349 CDS 100% 5.625 3.938 N Dnajc2 n/a
12 TRCN0000011449 GCAATGGTCTTGAAACATCAT pLKO.1 445 CDS 100% 4.950 3.465 N Dnajc2 n/a
13 TRCN0000008555 GCTTGAATGAAATCCTGGCTT pLKO.1 1289 CDS 100% 2.640 1.848 N Dnajc2 n/a
14 TRCN0000151590 GAGAAAGAAGAGGAAGAAGAT pLKO.1 1081 CDS 100% 4.950 2.970 N SAMD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535679.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11836 pDONR223 100% 12.9% 10.7% None (many diffs) n/a
2 ccsbBroad304_11836 pLX_304 0% 12.9% 10.7% V5 (many diffs) n/a
3 TRCN0000467850 GACATATCATTCCATTGCGATCGT pLX_317 84.2% 12.9% 10.7% V5 (many diffs) n/a
Download CSV