Transcript: Mouse XM_006535803.1

PREDICTED: Mus musculus putative homeodomain transcription factor 2 (Phtf2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phtf2 (68770)
Length:
4042
CDS:
428..1756

Additional Resources:

NCBI RefSeq record:
XM_006535803.1
NBCI Gene record:
Phtf2 (68770)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535803.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366040 CTGGTAATTGTTGACGTAATT pLKO_005 2056 3UTR 100% 13.200 18.480 N Phtf2 n/a
2 TRCN0000085755 GCGTCAGAACTTTATGTGATT pLKO.1 995 CDS 100% 4.950 6.930 N Phtf2 n/a
3 TRCN0000085756 CCCTTTAGGTTGTATGGACTT pLKO.1 1622 CDS 100% 4.050 5.670 N Phtf2 n/a
4 TRCN0000374256 TACTTGAGGAATACGTCTTTA pLKO_005 2146 3UTR 100% 13.200 10.560 N Phtf2 n/a
5 TRCN0000366042 ATAGAAAGCCACACCATTATA pLKO_005 521 CDS 100% 15.000 10.500 N Phtf2 n/a
6 TRCN0000085757 CGGTTCTAGCACCACAGATAA pLKO.1 99 5UTR 100% 13.200 9.240 N Phtf2 n/a
7 TRCN0000085753 GCGCTCTAATATGTCCAATAA pLKO.1 3350 3UTR 100% 13.200 9.240 N Phtf2 n/a
8 TRCN0000366041 GGCATAGGATACCAGGTATTT pLKO_005 884 CDS 100% 13.200 9.240 N Phtf2 n/a
9 TRCN0000374257 CAATACCTCAATCCTACTTAC pLKO_005 1486 CDS 100% 10.800 7.560 N Phtf2 n/a
10 TRCN0000017179 CCGGTTGAAGAAAGTACAGAA pLKO.1 1213 CDS 100% 4.950 3.465 N PHTF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535803.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03798 pDONR223 100% 52.4% 51% None (many diffs) n/a
2 ccsbBroad304_03798 pLX_304 0% 52.4% 51% V5 (many diffs) n/a
3 TRCN0000474694 TTCCGATACCCTGCCCGTAGGATC pLX_317 19.9% 52.4% 51% V5 (many diffs) n/a
4 ccsbBroadEn_15939 pDONR223 0% 22.2% 16.6% None (many diffs) n/a
5 ccsbBroad304_15939 pLX_304 0% 22.2% 16.6% V5 (many diffs) n/a
6 TRCN0000468673 ATTCAATCCGCAACACTGGTATCC pLX_317 48.1% 22.2% 16.6% V5 (many diffs) n/a
Download CSV