Transcript: Mouse XM_006536721.2

PREDICTED: Mus musculus DNA-directed RNA polymerases I, II, and III subunit RPABC4 (LOC102641086), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC102641086 (102641086)
Length:
239
CDS:
56..232

Additional Resources:

NCBI RefSeq record:
XM_006536721.2
NBCI Gene record:
LOC102641086 (102641086)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006536721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111411 GCAGCAGCCAATGATATATAT pLKO.1 88 CDS 100% 15.000 7.500 Y Polr2k n/a
2 TRCN0000332513 GCAGCAGCCAATGATATATAT pLKO_005 88 CDS 100% 15.000 7.500 Y Polr2k n/a
3 TRCN0000111413 GTGGAGAGTGTCACACCGAAA pLKO.1 111 CDS 100% 4.050 2.025 Y Polr2k n/a
4 TRCN0000332512 GTGGAGAGTGTCACACCGAAA pLKO_005 111 CDS 100% 4.050 2.025 Y Polr2k n/a
5 TRCN0000111414 GATAAAGTCCAGGGATCCCAT pLKO.1 136 CDS 100% 2.640 1.320 Y Polr2k n/a
6 TRCN0000332443 GATAAAGTCCAGGGATCCCAT pLKO_005 136 CDS 100% 2.640 1.320 Y Polr2k n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006536721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13922 pDONR223 100% 91.3% 94.8% None (many diffs) n/a
2 ccsbBroad304_13922 pLX_304 0% 91.3% 94.8% V5 (many diffs) n/a
3 TRCN0000472343 GATTGGCTTTTCCGTATGTTGTGT pLX_317 100% 91.3% 94.8% V5 (many diffs) n/a
Download CSV