Transcript: Mouse XM_006537785.3

PREDICTED: Mus musculus UDP-glucose ceramide glucosyltransferase (Ugcg), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ugcg (22234)
Length:
4012
CDS:
475..1572

Additional Resources:

NCBI RefSeq record:
XM_006537785.3
NBCI Gene record:
Ugcg (22234)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537785.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093768 CAAATGTCGATGCTAGATTAT pLKO.1 791 CDS 100% 13.200 18.480 N Ugcg n/a
2 TRCN0000316731 CAAATGTCGATGCTAGATTAT pLKO_005 791 CDS 100% 13.200 18.480 N Ugcg n/a
3 TRCN0000036124 GCCACCTTAGAGCAGGTATAT pLKO.1 1018 CDS 100% 13.200 18.480 N UGCG n/a
4 TRCN0000093765 CCATGTATTCAGATGGGATAT pLKO.1 1311 CDS 100% 10.800 8.640 N Ugcg n/a
5 TRCN0000316734 CCATGTATTCAGATGGGATAT pLKO_005 1311 CDS 100% 10.800 8.640 N Ugcg n/a
6 TRCN0000093767 CCGTGAATCCATGACAATCTA pLKO.1 1452 CDS 100% 5.625 4.500 N Ugcg n/a
7 TRCN0000316735 CCGTGAATCCATGACAATCTA pLKO_005 1452 CDS 100% 5.625 4.500 N Ugcg n/a
8 TRCN0000093764 CCATGAATTGAAGGCATCTTT pLKO.1 2367 3UTR 100% 5.625 3.938 N Ugcg n/a
9 TRCN0000316762 CCATGAATTGAAGGCATCTTT pLKO_005 2367 3UTR 100% 5.625 3.938 N Ugcg n/a
10 TRCN0000093766 GCCATTGATGTATGTAAGAAA pLKO.1 754 CDS 100% 5.625 3.938 N Ugcg n/a
11 TRCN0000316732 GCCATTGATGTATGTAAGAAA pLKO_005 754 CDS 100% 5.625 3.938 N Ugcg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537785.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07117 pDONR223 100% 85.1% 91.1% None (many diffs) n/a
2 ccsbBroad304_07117 pLX_304 0% 85.1% 91.1% V5 (many diffs) n/a
3 TRCN0000479529 TAATACGATTACTCACTCCCTCCT pLX_317 23.6% 85.1% 91.1% V5 (many diffs) n/a
Download CSV