Transcript: Mouse XM_006538084.3

PREDICTED: Mus musculus syndecan binding protein (Sdcbp), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sdcbp (53378)
Length:
2218
CDS:
224..1123

Additional Resources:

NCBI RefSeq record:
XM_006538084.3
NBCI Gene record:
Sdcbp (53378)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538084.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093445 CGAACACATTATTAAACGGAT pLKO.1 1051 CDS 100% 2.640 3.696 N Sdcbp n/a
2 TRCN0000093446 GATGGAAATCTGTATCCTAAA pLKO.1 350 CDS 100% 10.800 7.560 N Sdcbp n/a
3 TRCN0000093447 GCAGTGGACATGTTGGCTTTA pLKO.1 840 CDS 100% 10.800 7.560 N Sdcbp n/a
4 TRCN0000093444 CGCCTTAACTACAGTAAGCAT pLKO.1 1717 3UTR 100% 3.000 2.100 N Sdcbp n/a
5 TRCN0000093448 GCATTTGTTCTGGTGGATGCT pLKO.1 311 CDS 100% 2.640 1.848 N Sdcbp n/a
6 TRCN0000029156 GCAGAAATTAAGCAAGGGATT pLKO.1 542 CDS 100% 4.050 2.835 N SDCBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538084.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01512 pDONR223 100% 86.6% 90.3% None (many diffs) n/a
2 ccsbBroad304_01512 pLX_304 0% 86.6% 90.3% V5 (many diffs) n/a
3 TRCN0000470095 CAATAATGTCCATTTTTAATCTCT pLX_317 49.1% 86.6% 90.3% V5 (many diffs) n/a
Download CSV