Transcript: Mouse XM_006538208.1

PREDICTED: Mus musculus syntaxin 17 (Stx17), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stx17 (67727)
Length:
5889
CDS:
215..1120

Additional Resources:

NCBI RefSeq record:
XM_006538208.1
NBCI Gene record:
Stx17 (67727)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538208.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379887 CGCTCCAATATCCGAGAAATG pLKO_005 410 CDS 100% 10.800 15.120 N Stx17 n/a
2 TRCN0000100677 GCGAATGATAGATCCTGTCAA pLKO.1 478 CDS 100% 4.950 6.930 N Stx17 n/a
3 TRCN0000379687 GTCAGTGTATTTGTCAATTAT pLKO_005 1407 3UTR 100% 15.000 10.500 N Stx17 n/a
4 TRCN0000100676 GCGCTCCAATATCCGAGAAAT pLKO.1 409 CDS 100% 13.200 9.240 N Stx17 n/a
5 TRCN0000100675 GCTGGGTGTTAATGGAGATTT pLKO.1 1244 3UTR 100% 13.200 9.240 N Stx17 n/a
6 TRCN0000379904 GTGTCTGTCAGGTCAAGTTTA pLKO_005 1291 3UTR 100% 13.200 9.240 N Stx17 n/a
7 TRCN0000100679 TCAGAGTCTGACTCAGATATA pLKO.1 661 CDS 100% 13.200 9.240 N Stx17 n/a
8 TRCN0000380730 ATCCATAACTAAGGATCTAAG pLKO_005 1358 3UTR 100% 10.800 7.560 N Stx17 n/a
9 TRCN0000100678 CCAGATAAACATCGAGAAGTA pLKO.1 319 CDS 100% 4.950 3.465 N Stx17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538208.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12135 pDONR223 100% 38.8% 42.9% None (many diffs) n/a
2 ccsbBroad304_12135 pLX_304 0% 38.8% 42.9% V5 (many diffs) n/a
3 TRCN0000467994 TCGGGCTATCTAAAGCACTCATGG pLX_317 96.8% 38.8% 42.9% V5 (many diffs) n/a
Download CSV