Transcript: Mouse XM_006538305.3

PREDICTED: Mus musculus ring finger protein 38 (Rnf38), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf38 (73469)
Length:
5075
CDS:
393..1691

Additional Resources:

NCBI RefSeq record:
XM_006538305.3
NBCI Gene record:
Rnf38 (73469)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304988 TGGACTATCCATCGAACTTAA pLKO_005 1743 3UTR 100% 13.200 18.480 N Rnf38 n/a
2 TRCN0000041001 GCTTCCTTCGTACAGGTTCAA pLKO.1 1478 CDS 100% 4.950 6.930 N Rnf38 n/a
3 TRCN0000302812 GCTTCCTTCGTACAGGTTCAA pLKO_005 1478 CDS 100% 4.950 6.930 N Rnf38 n/a
4 TRCN0000040998 CCTCATTTCTAGCGATCCGTT pLKO.1 938 CDS 100% 2.640 3.696 N Rnf38 n/a
5 TRCN0000004621 TCCAGAGTGAAGATAGTCCAA pLKO.1 301 5UTR 100% 2.640 3.432 N RNF38 n/a
6 TRCN0000004620 CAATGTATAATCTGGTGTGTT pLKO.1 2238 3UTR 100% 4.950 3.960 N RNF38 n/a
7 TRCN0000040999 CGACATAATTCCATTAGTCAA pLKO.1 543 CDS 100% 4.950 3.960 N Rnf38 n/a
8 TRCN0000302739 CGACATAATTCCATTAGTCAA pLKO_005 543 CDS 100% 4.950 3.960 N Rnf38 n/a
9 TRCN0000304987 AGTACCTTACCCACCATTTAT pLKO_005 1211 CDS 100% 15.000 10.500 N Rnf38 n/a
10 TRCN0000427191 GACTGACTAAAGCAGATATTG pLKO_005 1453 CDS 100% 13.200 9.240 N RNF38 n/a
11 TRCN0000311188 CAGCACTTACCAGTACCATAT pLKO_005 903 CDS 100% 10.800 7.560 N Rnf38 n/a
12 TRCN0000041000 GCTTACTACCATACGTGCTAT pLKO.1 1303 CDS 100% 4.950 3.465 N Rnf38 n/a
13 TRCN0000041002 GCCATCCTAACAAGGTGATTT pLKO.1 190 5UTR 100% 13.200 7.920 N Rnf38 n/a
14 TRCN0000428659 GCCATCCTAACAAGGTGATTT pLKO_005 190 5UTR 100% 13.200 7.920 N RNF38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05061 pDONR223 100% 93.2% 98.1% None (many diffs) n/a
2 ccsbBroad304_05061 pLX_304 0% 93.2% 98.1% V5 (many diffs) n/a
3 TRCN0000480062 TGCATCGCAGAGCTACCTAGCGTC pLX_317 27.1% 93.2% 98.1% V5 (many diffs) n/a
Download CSV