Transcript: Mouse XM_006538542.1

PREDICTED: Mus musculus ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 (Acap3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acap3 (140500)
Length:
3972
CDS:
306..2681

Additional Resources:

NCBI RefSeq record:
XM_006538542.1
NBCI Gene record:
Acap3 (140500)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538542.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106125 GCCCACCAATGCCTTCAATTT pLKO.1 3643 3UTR 100% 13.200 9.240 N Acap3 n/a
2 TRCN0000106128 CTACAGGAGATGGTCAACTAT pLKO.1 432 CDS 100% 5.625 3.938 N Acap3 n/a
3 TRCN0000437735 ACACCGTCATCTCGGAATGTC pLKO_005 391 CDS 100% 4.950 3.465 N ACAP3 n/a
4 TRCN0000158197 CAAAGAGGATGTGCGGAAGTT pLKO.1 512 CDS 100% 4.950 3.465 N ACAP3 n/a
5 TRCN0000106129 CCTACAGGAGATGGTCAACTA pLKO.1 431 CDS 100% 4.950 3.465 N Acap3 n/a
6 TRCN0000106126 GCCTATGCTCTGTGAAACCAT pLKO.1 1126 CDS 100% 3.000 2.100 N Acap3 n/a
7 TRCN0000106127 GCTGACATTGTCACATTGCTT pLKO.1 2517 CDS 100% 3.000 2.100 N Acap3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538542.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09438 pDONR223 100% 81.4% 88.7% None (many diffs) n/a
2 ccsbBroad304_09438 pLX_304 0% 81.4% 88.7% V5 (many diffs) n/a
3 TRCN0000481075 CTGTTCATACGTCAGCGGCCGAGT pLX_317 18.4% 81.4% 88.7% V5 (many diffs) n/a
Download CSV