Transcript: Mouse XM_006538850.3

PREDICTED: Mus musculus WAS protein family, member 2 (Wasf2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wasf2 (242687)
Length:
5578
CDS:
236..1729

Additional Resources:

NCBI RefSeq record:
XM_006538850.3
NBCI Gene record:
Wasf2 (242687)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538850.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099310 CGGGTGTTATTATTCAGGAAA pLKO.1 3160 3UTR 100% 4.950 6.930 N Wasf2 n/a
2 TRCN0000332264 CGGGTGTTATTATTCAGGAAA pLKO_005 3160 3UTR 100% 4.950 6.930 N Wasf2 n/a
3 TRCN0000099312 GCCCGTCTTAGAGACCTATAA pLKO.1 589 CDS 100% 13.200 9.240 N Wasf2 n/a
4 TRCN0000354196 GCCCGTCTTAGAGACCTATAA pLKO_005 589 CDS 100% 13.200 9.240 N Wasf2 n/a
5 TRCN0000381783 CCAACATCACCCTGGCAAATG pLKO_005 321 CDS 100% 10.800 7.560 N WASF2 n/a
6 TRCN0000099314 AGTAAGTATGCAGAGGACATT pLKO.1 365 CDS 100% 4.950 3.465 N Wasf2 n/a
7 TRCN0000332263 AGTAAGTATGCAGAGGACATT pLKO_005 365 CDS 100% 4.950 3.465 N Wasf2 n/a
8 TRCN0000099311 CCCTCATACTTCTTTGATCTT pLKO.1 692 CDS 100% 4.950 3.465 N Wasf2 n/a
9 TRCN0000332189 CCCTCATACTTCTTTGATCTT pLKO_005 692 CDS 100% 4.950 3.465 N Wasf2 n/a
10 TRCN0000099313 CGGAAGATGATTCTTCTGAAT pLKO.1 1683 CDS 100% 0.495 0.347 N Wasf2 n/a
11 TRCN0000332188 CGGAAGATGATTCTTCTGAAT pLKO_005 1683 CDS 100% 0.495 0.347 N Wasf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538850.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489333 TCGACCAGCTTGAAATACATCAAC pLX_317 20.2% 87.6% 91.2% V5 (many diffs) n/a
2 TRCN0000488050 ACCCCCATTTCCCACGAATCATAG pLX_317 20.6% 87.6% 91.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV