Transcript: Mouse XM_006539040.3

PREDICTED: Mus musculus mitogen-activated protein kinase kinase kinase 6 (Map3k6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Map3k6 (53608)
Length:
5465
CDS:
1427..5278

Additional Resources:

NCBI RefSeq record:
XM_006539040.3
NBCI Gene record:
Map3k6 (53608)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539040.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025159 GCACTGTAATCGAGATGGCAA pLKO.1 3915 CDS 100% 2.640 3.696 N Map3k6 n/a
2 TRCN0000025162 CACAGACTCTTGCGGCTATTT pLKO.1 2089 CDS 100% 13.200 9.240 N Map3k6 n/a
3 TRCN0000339086 CACAGACTCTTGCGGCTATTT pLKO_005 2089 CDS 100% 13.200 9.240 N Map3k6 n/a
4 TRCN0000351011 GACATCAAAGGACACAGATAC pLKO_005 5280 3UTR 100% 10.800 7.560 N Map3k6 n/a
5 TRCN0000025161 GAGAGCACTATTAGCTTCTAT pLKO.1 3638 CDS 100% 5.625 3.938 N Map3k6 n/a
6 TRCN0000339087 GAGAGCACTATTAGCTTCTAT pLKO_005 3638 CDS 100% 5.625 3.938 N Map3k6 n/a
7 TRCN0000025160 CCTTCCTACTGTACCAGCATT pLKO.1 2844 CDS 100% 4.950 3.465 N Map3k6 n/a
8 TRCN0000025163 CTACAGGAACTGAGTGTAGAT pLKO.1 5072 CDS 100% 0.495 0.347 N Map3k6 n/a
9 TRCN0000339088 CTACAGGAACTGAGTGTAGAT pLKO_005 5072 CDS 100% 0.495 0.347 N Map3k6 n/a
10 TRCN0000197175 GCTTCAGCATGACCAACAATG pLKO.1 1842 CDS 100% 10.800 7.560 N MAP3K6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539040.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11332 pDONR223 100% 52.7% 55.3% None (many diffs) n/a
2 ccsbBroad304_11332 pLX_304 0% 52.7% 55.3% V5 (many diffs) n/a
3 TRCN0000481050 TGATCAGTTTTTGCCATGAGCGTT pLX_317 11.9% 52.7% 55.3% V5 (many diffs) n/a
4 ccsbBroadEn_14926 pDONR223 0% 52.7% 55.3% None (many diffs) n/a
5 ccsbBroad304_14926 pLX_304 0% 52.7% 55.3% V5 (many diffs) n/a
6 TRCN0000465376 CGCAATTACCGCCGTCAACACTGT pLX_317 11.6% 52.7% 55.3% V5 (many diffs) n/a
Download CSV