Transcript: Mouse XM_006539197.2

PREDICTED: Mus musculus glycine/arginine rich protein 1 (Grrp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grrp1 (72690)
Length:
1798
CDS:
639..1550

Additional Resources:

NCBI RefSeq record:
XM_006539197.2
NBCI Gene record:
Grrp1 (72690)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539197.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265511 TAGCCCGGTCCGTGAACAAAT pLKO_005 1585 3UTR 100% 13.200 18.480 N Grrp1 n/a
2 TRCN0000254407 GCAAGGCTTCGGTGAACAAAG pLKO_005 1012 CDS 100% 10.800 15.120 N Grrp1 n/a
3 TRCN0000254405 GTCGGAGAAAGAGCGATTCTT pLKO_005 1211 CDS 100% 5.625 7.875 N Grrp1 n/a
4 TRCN0000254404 GCCAAGACCTGACTCCCTTAT pLKO_005 968 CDS 100% 10.800 8.640 N Grrp1 n/a
5 TRCN0000254406 AGACGCACCAGGTGATTGTAC pLKO_005 823 CDS 100% 4.950 3.465 N Grrp1 n/a
6 TRCN0000141083 CAAGGCTTCGGTGAACAAAGA pLKO.1 1013 CDS 100% 4.950 3.465 N FAM110D n/a
7 TRCN0000142364 GCTTCGGTGAACAAAGAGAAC pLKO.1 1017 CDS 100% 4.050 2.835 N FAM110D n/a
8 TRCN0000142194 GTGAACAAAGAGAACGCCAAG pLKO.1 1023 CDS 100% 2.250 1.575 N FAM110D n/a
9 TRCN0000141721 GAAGCCGACAAAGCCAAGTAT pLKO.1 798 CDS 100% 5.625 3.375 N FAM110D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539197.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08988 pDONR223 100% 77.7% 77.8% None (many diffs) n/a
2 ccsbBroad304_08988 pLX_304 0% 77.7% 77.8% V5 (many diffs) n/a
3 TRCN0000481540 ATTGGGGCATGCCGCAGCAGTCAT pLX_317 52.1% 77.6% 77.5% V5 (many diffs) n/a
Download CSV