Transcript: Mouse XM_006539528.3

PREDICTED: Mus musculus dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b (Dyrk1b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dyrk1b (13549)
Length:
1587
CDS:
275..1501

Additional Resources:

NCBI RefSeq record:
XM_006539528.3
NBCI Gene record:
Dyrk1b (13549)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539528.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435463 ACATCAATGAGGTATACTATG pLKO_005 627 CDS 100% 10.800 15.120 N Dyrk1b n/a
2 TRCN0000416984 TACTACATAGTACACCTTAAG pLKO_005 965 CDS 100% 10.800 15.120 N Dyrk1b n/a
3 TRCN0000412749 ACAGATTGAGCTACGGCTGTT pLKO_005 910 CDS 100% 4.050 5.670 N Dyrk1b n/a
4 TRCN0000418794 GTGGACCAGATGAGCCGTATT pLKO_005 1489 CDS 100% 10.800 8.640 N Dyrk1b n/a
5 TRCN0000433605 ATCACCTGTGCCTGGTGTTTG pLKO_005 1005 CDS 100% 10.800 7.560 N Dyrk1b n/a
6 TRCN0000427288 CCAAGGCTCGAAAGTACTTTG pLKO_005 1556 3UTR 100% 10.800 7.560 N Dyrk1b n/a
7 TRCN0000419572 ATGACCTGGCCATTGACATGT pLKO_005 1403 CDS 100% 4.950 3.465 N Dyrk1b n/a
8 TRCN0000023028 CCAGCATGATACAGAGATGAA pLKO.1 943 CDS 100% 4.950 3.465 N Dyrk1b n/a
9 TRCN0000002139 GACCTACAAGCACATCAATGA pLKO.1 616 CDS 100% 4.950 3.465 N DYRK1B n/a
10 TRCN0000023024 GCTATGAGATTGACTCTCTTA pLKO.1 783 CDS 100% 4.950 3.465 N Dyrk1b n/a
11 TRCN0000023026 CCACGGTTATGATGACGACAA pLKO.1 721 CDS 100% 4.050 2.835 N Dyrk1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539528.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489760 AATATGTTGATGCCGAGACCTTCC pLX_317 16.8% 44.2% 38.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14931 pDONR223 0% 41.7% 36.7% None (many diffs) n/a
3 ccsbBroad304_14931 pLX_304 0% 41.7% 36.7% V5 (many diffs) n/a
4 TRCN0000479503 CGCACGTACGGTCGGCCCGAATGT pLX_317 16.1% 41.7% 36.7% V5 (many diffs) n/a
Download CSV