Construct: ORF TRCN0000489760
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020267.1_s317c1
- DNA Barcode:
- AATATGTTGATGCCGAGACCTTCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- DYRK1B (9149)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489760
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9149 | DYRK1B | dual specificity tyrosine p... | NM_006483.3 | 100% | 100% | |
| 2 | human | 9149 | DYRK1B | dual specificity tyrosine p... | NM_006484.2 | 98% | 98% | 1094_1129del |
| 3 | human | 9149 | DYRK1B | dual specificity tyrosine p... | NM_004714.3 | 93.6% | 93.6% | 1094_1213del |
| 4 | human | 9149 | DYRK1B | dual specificity tyrosine p... | XM_005259398.4 | 93.6% | 93.6% | 1094_1213del |
| 5 | mouse | 13549 | Dyrk1b | dual-specificity tyrosine-(... | NM_010092.2 | 92.2% | 97.1% | (many diffs) |
| 6 | mouse | 13549 | Dyrk1b | dual-specificity tyrosine-(... | NM_001037957.3 | 86.3% | 90.9% | (many diffs) |
| 7 | mouse | 13549 | Dyrk1b | dual-specificity tyrosine-(... | XM_006539527.3 | 83.7% | 88.1% | (many diffs) |
| 8 | mouse | 13549 | Dyrk1b | dual-specificity tyrosine-(... | XM_006539526.3 | 82.1% | 86.5% | (many diffs) |
| 9 | mouse | 13549 | Dyrk1b | dual-specificity tyrosine-(... | NM_001271370.1 | 78.8% | 83% | (many diffs) |
| 10 | mouse | 13549 | Dyrk1b | dual-specificity tyrosine-(... | XM_006539528.3 | 44.2% | 38.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1839
- ORF length:
- 1767
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggccgtc ccaccgggcc atggtccctt ctctggcttc ccagggcccc 121 aggagcacac gcaggtattg cctgatgtgc ggctactgcc tcggaggctg cccctggcct 181 tccgggatgc aacctcagcc ccgctgcgta agctctctgt ggacctcatc aagacctaca 241 agcacatcaa tgaggtatac tatgcgaaga agaagcggcg ggcccagcag gcgccacccc 301 aggattcgag caacaagaag gagaagaagg tcctgaacca tggttatgat gacgacaacc 361 atgactacat cgtgcgcagt ggcgagcgct ggctggagcg ctacgaaatt gactcgctca 421 ttggcaaagg ctcctttggc caggtggtga aagcctatga tcatcagacc caggagcttg 481 tggccatcaa gatcatcaag aacaaaaagg ctttcctgaa ccaggcccag attgagctgc 541 ggctgctgga gctgatgaac cagcatgaca cggagatgaa gtactatata gtacacctga 601 agcggcactt catgttccgg aaccacctgt gcctggtatt tgagctgctg tcctacaacc 661 tgtacgacct cctgcgcaac acccacttcc gcggcgtctc gctgaacctg acccggaagc 721 tggcgcagca gctctgcacg gcactgctct ttctggccac gcctgagctc agcatcattc 781 actgcgacct caagcccgaa aacatcttgc tgtgcaaccc caagcgcagc gccatcaaga 841 ttgtggactt cggcagctcc tgccagcttg gccagaggat ctaccagtat atccagagcc 901 gcttctaccg ctcacctgag gtgctcctgg gcacacccta cgacctggcc attgacatgt 961 ggtccctggg ctgcatcctt gtggagatgc acaccggaga gcccctcttc agtggctcca 1021 atgaggtcga ccagatgaac cgcattgtgg aggtgctggg catcccaccg gccgccatgc 1081 tggaccaggc gcccaaggct cgcaagtact ttgaacggct gcctgggggt ggctggaccc 1141 tacgaaggac gaaagaactc aggaaggacc tggtgctgcg catgctggag tatgagcccg 1201 ccgcccgcat cagccccctg ggggctctgc agcacggctt cttccgccgc acggccgacg 1261 aggccaccaa cacgggcccg gcaggcagca gtgcctccac ctcgcccgcg cccctcgaca 1321 cctgcccctc ttccagcacc gccagctcca tctccagttc tggaggctcc agtggctcct 1381 ccagtgacaa ccggacctac cgctacagca accgatattg tgggggccct gggcccccta 1441 tcacagactg tgagatgaac agcccccagg tcccaccctc ccagccgctg cggccctggg 1501 cagggggtga tgtgccccac aagacacatc aagcccctgc ctctgcctcG TCACTGCCTG 1561 GGACCGGGGC CCAGTTACCC CCCCAGCCCC GATACCTTGG TCGTCCCCCA TCACCAACCT 1621 CACCACCACC CCCGGAGCTG ATGGATGTGA GCCTGGTGGG CGGCCCTGCT GACTGCTCCC 1681 CACCTCACCC AGCGCCTGCC CCCCAGCACC CGGCTGCCTC AGCCCTCCGG ACTCGGATGA 1741 CTGGAGGTCG TCCACCCCTC CCGCCTCCTG ATGACCCTGC CACTCTGGGG CCTCACCTGG 1801 GCCTCCGTGG TGTACCCCAG AGCACAGCAG CCAGCTCGTG AGACCCAGCT TTCTTGTACA 1861 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1921 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1981 AGGACGAAAT ATGTTGATGC CGAGACCTTC CACGCGTTAA GTCgacaatc aacctctgga 2041 ttacaaaatt tgtgaaagat t