Transcript: Mouse XM_006539660.3

PREDICTED: Mus musculus POU domain, class 2, transcription factor 2 (Pou2f2), transcript variant X14, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pou2f2 (18987)
Length:
3516
CDS:
239..1705

Additional Resources:

NCBI RefSeq record:
XM_006539660.3
NBCI Gene record:
Pou2f2 (18987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539660.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420194 GCTACCAACGCCAAATCTATT pLKO_005 727 CDS 100% 13.200 18.480 N Pou2f2 n/a
2 TRCN0000081519 ACCCGACATTAACCATCAGAA pLKO.1 358 CDS 100% 4.950 6.930 N Pou2f2 n/a
3 TRCN0000432692 CAACGACGCAGAGACTATGTC pLKO_005 1060 CDS 100% 4.950 6.930 N Pou2f2 n/a
4 TRCN0000081518 CTTAGTAACCTCGCCTCTCTT pLKO.1 1760 3UTR 100% 4.950 6.930 N Pou2f2 n/a
5 TRCN0000081520 GAGCACAACAGTTACTACCTT pLKO.1 1453 CDS 100% 3.000 4.200 N Pou2f2 n/a
6 TRCN0000425508 GAGCACACAGACACCGAAAGA pLKO_005 332 CDS 100% 4.950 3.960 N Pou2f2 n/a
7 TRCN0000081522 CAAGCTCTATGGCAACGACTT pLKO.1 952 CDS 100% 4.050 3.240 N Pou2f2 n/a
8 TRCN0000245326 CAGTCTGAGCACAACAGTTAC pLKO_005 1447 CDS 100% 10.800 7.560 N POU2F2 n/a
9 TRCN0000020820 GCACAACAGTTACTACCTTAT pLKO.1 1455 CDS 100% 10.800 7.560 N POU2F2 n/a
10 TRCN0000431611 GACCAGCATCGAGACGAATGT pLKO_005 1168 CDS 100% 4.950 3.465 N Pou2f2 n/a
11 TRCN0000020821 GCACACAGACACCGAAAGAAA pLKO.1 334 CDS 100% 5.625 3.375 N POU2F2 n/a
12 TRCN0000081521 CTTCGCCTTAGAGAAGAGTTT pLKO.1 1192 CDS 100% 4.950 2.475 Y Pou2f2 n/a
13 TRCN0000337344 AGCTTCAAGAACATGTGTAAG pLKO_005 1013 CDS 100% 10.800 6.480 N POU5F1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539660.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11047 pDONR223 100% 76.4% 76.2% None (many diffs) n/a
2 ccsbBroad304_11047 pLX_304 42.1% 76.4% 76.2% V5 (many diffs) n/a
3 TRCN0000470280 ATCGGTGCCCCACATGACGGCCCA pLX_317 23.7% 76.4% 76.2% V5 (many diffs) n/a
Download CSV