Transcript: Mouse XM_006539678.3

PREDICTED: Mus musculus URI1, prefoldin-like chaperone (Uri1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Uri1 (19777)
Length:
3112
CDS:
216..1589

Additional Resources:

NCBI RefSeq record:
XM_006539678.3
NBCI Gene record:
Uri1 (19777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539678.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095386 GCTGGGTGAACTTGAAAGTAA pLKO.1 656 CDS 100% 5.625 7.875 N Uri1 n/a
2 TRCN0000375861 TGTCATACTGTAATCTTTAAG pLKO_005 2047 3UTR 100% 13.200 10.560 N Uri1 n/a
3 TRCN0000348916 TGTTCTGCTGGCTTCGTTAAT pLKO_005 1738 3UTR 100% 13.200 10.560 N Uri1 n/a
4 TRCN0000095388 TCAAGTCAATAGTCTGAACTA pLKO.1 833 CDS 100% 4.950 3.960 N Uri1 n/a
5 TRCN0000095384 CCTGGTTTAGATTGTGTATAA pLKO.1 2187 3UTR 100% 13.200 9.240 N Uri1 n/a
6 TRCN0000375862 GATGTTGTGAATGGAGAATAT pLKO_005 1173 CDS 100% 13.200 9.240 N Uri1 n/a
7 TRCN0000348915 TCTCATACTGTTGAACCTAAA pLKO_005 999 CDS 100% 10.800 7.560 N Uri1 n/a
8 TRCN0000095385 CCATCAAGAGTCCTGCTGATA pLKO.1 1135 CDS 100% 4.950 3.465 N Uri1 n/a
9 TRCN0000352280 CCATCAAGAGTCCTGCTGATA pLKO_005 1135 CDS 100% 4.950 3.465 N Uri1 n/a
10 TRCN0000095387 CCATCAGAAGTATCAGAGGAA pLKO.1 1515 CDS 100% 2.640 1.848 N Uri1 n/a
11 TRCN0000348850 ATGCTATTTCAGCAGATAATT pLKO_005 958 CDS 100% 15.000 9.000 N Uri1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539678.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14003 pDONR223 100% 74.1% 25.9% None (many diffs) n/a
2 ccsbBroad304_14003 pLX_304 0% 74.1% 25.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477196 TTAATAACCAAAATTCCCTTCCCA pLX_317 25.9% 74.1% 25.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV