Transcript: Mouse XM_006539961.3

PREDICTED: Mus musculus teashirt zinc finger family member 3 (Tshz3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tshz3 (243931)
Length:
5224
CDS:
127..3504

Additional Resources:

NCBI RefSeq record:
XM_006539961.3
NBCI Gene record:
Tshz3 (243931)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539961.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015633 CCCTTACATCACGCCAAATAA pLKO.1 1329 CDS 100% 15.000 21.000 N TSHZ3 n/a
2 TRCN0000230689 ACCCTTACATCACGCCAAATA pLKO_005 1328 CDS 100% 13.200 18.480 N TSHZ3 n/a
3 TRCN0000426249 ACCCTTACATCACGCCAAATA pLKO_005 1328 CDS 100% 13.200 18.480 N Tshz3 n/a
4 TRCN0000081705 GCCCTAAAGGTGGACTAGATA pLKO.1 1802 CDS 100% 5.625 7.875 N Tshz3 n/a
5 TRCN0000081704 CCGCTATTTCTACCACGTCAA pLKO.1 2592 CDS 100% 4.050 5.670 N Tshz3 n/a
6 TRCN0000015635 CGTCGTATCATTCATGTCAAA pLKO.1 2745 CDS 100% 4.950 3.960 N TSHZ3 n/a
7 TRCN0000081703 GCCTCTGTATAGTGTATATTT pLKO.1 4216 3UTR 100% 15.000 10.500 N Tshz3 n/a
8 TRCN0000434301 AGAGGAGGAGAAGTATGATAT pLKO_005 1737 CDS 100% 13.200 9.240 N Tshz3 n/a
9 TRCN0000446791 CCAAGACCTGAGCGTCCATAT pLKO_005 1119 CDS 100% 10.800 7.560 N Tshz3 n/a
10 TRCN0000015634 CCAGCCCATAGACTTGACAAA pLKO.1 2619 CDS 100% 4.950 3.465 N TSHZ3 n/a
11 TRCN0000081707 GCCTTGGTAGAAGATGACGTA pLKO.1 328 CDS 100% 2.640 1.848 N Tshz3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539961.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12376 pDONR223 100% 70.6% 76.6% None (many diffs) n/a
2 ccsbBroad304_12376 pLX_304 0% 70.6% 76.6% V5 (many diffs) n/a
3 TRCN0000478931 GCTCAAAGTGGATCAGTACATAAA pLX_317 15% 70.6% 76.6% V5 (many diffs) n/a
Download CSV