Transcript: Mouse XM_006540345.3

PREDICTED: Mus musculus charged multivesicular body protein 2A (Chmp2a), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chmp2a (68953)
Length:
924
CDS:
195..863

Additional Resources:

NCBI RefSeq record:
XM_006540345.3
NBCI Gene record:
Chmp2a (68953)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540345.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217186 CTATGAACAGACAGCTGAAAT pLKO.1 529 CDS 100% 13.200 18.480 N Chmp2a n/a
2 TRCN0000198731 CGGAGATATGTACGCAAGTTT pLKO.1 402 CDS 100% 5.625 7.875 N Chmp2a n/a
3 TRCN0000337550 CCGGAGATATGTACGCAAGTT pLKO_005 401 CDS 100% 4.950 6.930 N Chmp2a n/a
4 TRCN0000177200 GAAATGATGAATGACGCAATT pLKO.1 615 CDS 100% 10.800 8.640 N Chmp2a n/a
5 TRCN0000276845 GAAATGATGAATGACGCAATT pLKO_005 615 CDS 100% 10.800 8.640 N Chmp2a n/a
6 TRCN0000182300 GAAGGGTGTTACTAAGGCCAT pLKO.1 503 CDS 100% 2.160 1.728 N Chmp2a n/a
7 TRCN0000198105 CCTCAAGATACAGACTCTAAA pLKO.1 455 CDS 100% 13.200 9.240 N Chmp2a n/a
8 TRCN0000323519 CCTCAAGATACAGACTCTAAA pLKO_005 455 CDS 100% 13.200 9.240 N Chmp2a n/a
9 TRCN0000276846 GGAACGACAGAAACTAGAAAC pLKO_005 287 CDS 100% 10.800 7.560 N Chmp2a n/a
10 TRCN0000276843 ATGGATGCTGTTCGAATCATG pLKO_005 360 CDS 100% 4.950 3.465 N Chmp2a n/a
11 TRCN0000182144 CAAGCCATGAAGGGTGTTACT pLKO.1 495 CDS 100% 4.950 3.465 N Chmp2a n/a
12 TRCN0000276844 CAAGCCATGAAGGGTGTTACT pLKO_005 495 CDS 100% 4.950 3.465 N Chmp2a n/a
13 TRCN0000145250 GAAGATCATGATGGAGTTTGA pLKO.1 563 CDS 100% 4.950 3.465 N CHMP2A n/a
14 TRCN0000200397 GAAGAGGAGAGTGATGCTGTT pLKO.1 663 CDS 100% 4.050 2.835 N Chmp2a n/a
15 TRCN0000337487 CTCACAGATGAGCTGTCAAAC pLKO_005 717 CDS 100% 10.800 6.480 N Chmp2a n/a
16 TRCN0000144104 CAGAAGATCATGATGGAGTTT pLKO.1 561 CDS 100% 4.950 2.970 N CHMP2A n/a
17 TRCN0000142935 CCAGATCCAGAAGATCATGAT pLKO.1 554 CDS 100% 4.950 2.970 N CHMP2A n/a
18 TRCN0000122300 CCAGAAGATCATGATGGAGTT pLKO.1 560 CDS 100% 4.050 2.430 N CHMP2A n/a
19 TRCN0000198826 CAGAAACTAGAAACCCAGGAA pLKO.1 294 CDS 100% 2.640 1.584 N Chmp2a n/a
20 TRCN0000143522 GAAGATGAAGAGGAGAGTGAT pLKO.1 657 CDS 100% 4.950 2.475 Y CHMP2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540345.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03011 pDONR223 100% 90.6% 99.5% None (many diffs) n/a
2 ccsbBroad304_03011 pLX_304 0% 90.6% 99.5% V5 (many diffs) n/a
3 TRCN0000472187 AATCTTGACCTTACTTGCCGGGTG pLX_317 68.3% 90.6% 99.5% V5 (many diffs) n/a
Download CSV