Transcript: Mouse XM_006540574.3

PREDICTED: Mus musculus amyloid beta (A4) precursor protein-binding, family A, member 2 (Apba2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Apba2 (11784)
Length:
3286
CDS:
306..2558

Additional Resources:

NCBI RefSeq record:
XM_006540574.3
NBCI Gene record:
Apba2 (11784)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540574.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093562 GAAGGAATATAGCGACATCAT pLKO.1 1928 CDS 100% 4.950 6.930 N Apba2 n/a
2 TRCN0000093560 CCAGAGGATCAAGGTCTTAAA pLKO.1 1613 CDS 100% 13.200 9.240 N Apba2 n/a
3 TRCN0000093559 CCTGAGGCTATGGAATGTGAA pLKO.1 2999 3UTR 100% 4.950 3.465 N Apba2 n/a
4 TRCN0000093561 GCCCACTGACAATAACAACAT pLKO.1 1313 CDS 100% 4.950 3.465 N Apba2 n/a
5 TRCN0000093563 CCAGAAGGAATATAGCGACAT pLKO.1 1925 CDS 100% 4.050 2.835 N Apba2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540574.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05830 pDONR223 100% 86.2% 90.9% None (many diffs) n/a
2 ccsbBroad304_05830 pLX_304 0% 86.2% 90.9% V5 (many diffs) n/a
3 TRCN0000477800 GTGCTTAGGGTTCGAATAACGTTA pLX_317 8.5% 86.2% 90.9% V5 (many diffs) n/a
Download CSV