Transcript: Human XM_006711492.4

PREDICTED: Homo sapiens G protein-coupled receptor 89A (GPR89A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPR89A (653519)
Length:
2298
CDS:
118..1485

Additional Resources:

NCBI RefSeq record:
XM_006711492.4
NBCI Gene record:
GPR89A (653519)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711492.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244549 CTTCATTCTTGTTGGAATAAT pLKO_005 1149 CDS 100% 15.000 7.500 Y GPR89B n/a
2 TRCN0000243822 GAATAGCAGCTCCCGTTATTT pLKO_005 315 CDS 100% 15.000 7.500 Y GPR89A n/a
3 TRCN0000244548 TTCATGGCTACCATCAATATT pLKO_005 1021 CDS 100% 15.000 7.500 Y GPR89B n/a
4 TRCN0000243824 ATGTGACTGACACGGATATTC pLKO_005 656 CDS 100% 13.200 6.600 Y GPR89A n/a
5 TRCN0000358298 ATTACCTCCCAGATACTATTT pLKO_005 148 CDS 100% 13.200 6.600 Y GPR89B n/a
6 TRCN0000014506 CCTGCTATTAGCACAGATAAT pLKO.1 1257 CDS 100% 13.200 6.600 Y GPR89B n/a
7 TRCN0000014504 CCTTCATTCTTGTTGGAATAA pLKO.1 1148 CDS 100% 13.200 6.600 Y GPR89B n/a
8 TRCN0000243823 GATTACCTCCCAGATACTATT pLKO_005 147 CDS 100% 13.200 6.600 Y GPR89A n/a
9 TRCN0000244550 TCTGGAAACAGCTGATCTATA pLKO_005 903 CDS 100% 13.200 6.600 Y GPR89B n/a
10 TRCN0000363142 TGAATAGCAGCTCCCGTTATT pLKO_005 314 CDS 100% 13.200 6.600 Y GPR89B n/a
11 TRCN0000244551 TTAGAATACCGCACCATAATC pLKO_005 1327 CDS 100% 13.200 6.600 Y GPR89B n/a
12 TRCN0000243821 ACTATGAGATACGTCAGTATG pLKO_005 212 CDS 100% 10.800 5.400 Y GPR89A n/a
13 TRCN0000358303 CAATATCCGACTACTGCATAA pLKO_005 417 CDS 100% 10.800 5.400 Y GPR89B n/a
14 TRCN0000244552 TGAGCCAAACACGTAGGATTT pLKO_005 1691 3UTR 100% 10.800 5.400 Y GPR89B n/a
15 TRCN0000014505 CGCCAATTGTTTAAAGACTAT pLKO.1 196 CDS 100% 4.950 2.475 Y GPR89B n/a
16 TRCN0000014507 CGCTCTCTCTAGCATACTCTT pLKO.1 1416 CDS 100% 4.950 2.475 Y GPR89B n/a
17 TRCN0000014503 GCCAAGAAACTAAAGGTGAAA pLKO.1 1630 3UTR 100% 4.950 2.475 Y GPR89B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711492.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489448 TTCGCTAATGTGAAGCACCGCCCG pLX_317 23.4% 99.9% 99.7% V5 1365_1366insG n/a
2 ccsbBroadEn_14517 pDONR223 100% 99.8% .8% None 12C>T;14delT n/a
3 ccsbBroad304_14517 pLX_304 0% 99.8% .8% V5 (not translated due to prior stop codon) 12C>T;14delT n/a
4 TRCN0000479192 GTTGGTCCATCTGCCGAGCCGACT pLX_317 29.6% 99.8% .8% V5 (not translated due to prior stop codon) 12C>T;14delT n/a
Download CSV