Construct: ORF TRCN0000479192
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004738.1_s317c1
- Derived from:
- ccsbBroadEn_14517
- DNA Barcode:
- GTTGGTCCATCTGCCGAGCCGACT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- GPR89A (653519)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479192
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 653519 | GPR89A | G protein-coupled receptor 89A | NM_001097612.2 | 99.8% | .8% | 12C>T;14delT |
| 2 | human | 51463 | GPR89B | G protein-coupled receptor 89B | NM_001350180.1 | 99.8% | .8% | 12G>T;14delT |
| 3 | human | 51463 | GPR89B | G protein-coupled receptor 89B | NM_016334.5 | 99.8% | .8% | 12G>T;14delT |
| 4 | human | 653519 | GPR89A | G protein-coupled receptor 89A | XM_006711492.4 | 99.8% | .8% | 12C>T;14delT |
| 5 | human | 653519 | GPR89A | G protein-coupled receptor 89A | NM_001097613.2 | 94.5% | .9% | 0_1ins74 |
| 6 | human | 51463 | GPR89B | G protein-coupled receptor 89B | NM_001350181.1 | 94.5% | .9% | 0_1ins74 |
| 7 | human | 51463 | GPR89B | G protein-coupled receptor 89B | NM_001350182.1 | 94.5% | .9% | 0_1ins74 |
| 8 | human | 51463 | GPR89B | G protein-coupled receptor 89B | XM_005277402.4 | 94.5% | .9% | 0_1ins74 |
| 9 | human | 653519 | GPR89A | G protein-coupled receptor 89A | XM_011509908.2 | 94.5% | .9% | 0_1ins74 |
| 10 | human | 653519 | GPR89A | G protein-coupled receptor 89A | XM_011509909.2 | 94.5% | .9% | 0_1ins74 |
| 11 | human | 51463 | GPR89B | G protein-coupled receptor 89B | XM_017001448.2 | 94.5% | .9% | 0_1ins74 |
| 12 | human | 51463 | GPR89B | G protein-coupled receptor 89B | NM_001350183.1 | 73.6% | 1.1% | 0_1ins359 |
| 13 | human | 51463 | GPR89B | G protein-coupled receptor 89B | NM_001350184.1 | 73.6% | 1.1% | 0_1ins359 |
| 14 | human | 653519 | GPR89A | G protein-coupled receptor 89A | XM_006711493.3 | 73.6% | 1.1% | 0_1ins359 |
| 15 | human | 51463 | GPR89B | G protein-coupled receptor 89B | XM_011509612.2 | 73.6% | 1.1% | 0_1ins359 |
| 16 | human | 653519 | GPR89A | G protein-coupled receptor 89A | NR_036541.1 | 68% | (many diffs) | |
| 17 | human | 51463 | GPR89B | G protein-coupled receptor 89B | XR_001737221.1 | 62.2% | (many diffs) | |
| 18 | human | 51463 | GPR89B | G protein-coupled receptor 89B | XM_017001449.1 | 55% | 1.5% | (many diffs) |
| 19 | human | 653519 | GPR89A | G protein-coupled receptor 89A | XM_017002150.2 | 55% | 1.5% | (many diffs) |
| 20 | human | 653519 | GPR89A | G protein-coupled receptor 89A | XR_001737373.2 | 54.1% | (many diffs) | |
| 21 | human | 51463 | GPR89B | G protein-coupled receptor 89B | XM_011509613.2 | 53.6% | 1.6% | (many diffs) |
| 22 | human | 653519 | GPR89A | G protein-coupled receptor 89A | XM_011509910.3 | 53.6% | 1.6% | (many diffs) |
| 23 | mouse | 67549 | Gpr89 | G protein-coupled receptor 89 | NM_026229.4 | 88.3% | .8% | (many diffs) |
| 24 | mouse | 67549 | Gpr89 | G protein-coupled receptor 89 | XM_017319696.1 | 65.1% | .8% | (many diffs) |
| 25 | mouse | 67549 | Gpr89 | G protein-coupled receptor 89 | XR_375569.3 | 25.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 93
- ORF length:
- 27
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag tttccttacg actccagcat catgattacc tcccagatac tattttttgg 121 atttgggtgg cttttcttca tgcgccaatt gtttaaagac tatgagatac gtcagtatgt 181 tgtacaggtg atcttctccg tgacgtttgc attttcttgc accatgtttg agctcatcat 241 ctttgaaatc ttaggagtat tgaatagcag ctcccgttat tttcactgga aaatgaacct 301 gtgtgtaatt ctgctgatcc tggttttcat ggtgcctttt tacattggct attttattgt 361 gagcaatatc cgactactgc ataaacaacg actgcttttt tcctgtctct tatggctgac 421 ctttatgtat ttcttctgga aactaggaga tccctttccc attctcagcc caaaacatgg 481 gatcttatcc atagaacagc tcatcagccg ggttggtgtg attggagtga ctctcatggc 541 tcttctttct ggatttggtg ctgtcaactg cccatacact tacatgtctt acttcctcag 601 gaatgtgact gacacggata ttctagccct ggaacggcga ctgctgcaaa ccatggatat 661 gatcataagc aaaaagaaaa ggatggcaat ggcacggaga acaatgttcc agaaggggga 721 agtgcataac aaaccatcag gtttctgggg aatgataaaa agtgttacca cttcagcatc 781 aggaagtgaa aatcttactc ttattcaaca ggaagtggat gctttggaag aattaagcag 841 gcagcttttt ctggaaacag ctgatctata tgctaccaag gagagaatag aatactccaa 901 aaccttcaag gggaaatatt ttaattttct tggttacttt ttctctattt actgtgtttg 961 gaaaattttc atggctacca tcaatattgt ttttgatcga gttgggaaaa cggatcctgt 1021 cacaagaggC ATTGAGATCA CTGTGAATTA TCTGGGAATC CAATTTGATG TGAAGTTTTG 1081 GTCCCAACAC ATTTCCTTCA TTCTTGTTGG AATAATCATC GTCACATCCA TCAGAGGATT 1141 GCTGATCACT CTTACCAAGT TCTTTTATGC CATCTCTAGC AGTAAGTCCT CCAATGTCAT 1201 TGTCCTGCTA TTAGCACAGA TAATGGGCAT GTACTTTGTC TCCTCTGTGC TGCTGATCCG 1261 AATGAGTATG CCTTTAGAAT ACCGCACCAT AATCACTGAA GTCCTTGGAG AACTGCAGTT 1321 CAACTTCTAT CACCGTTGGT TTGATGTGAT CTTCCTGGTC AGCGCTCTCT CTAGCATACT 1381 CTTCCTCTAT TTGGCTCACA AACAGGCACC AGAGAAGCAA ATGGCACCTT GCCCAACTTT 1441 CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC 1501 TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC 1561 TTGTGGAAAG GACGAGTTGG TCCATCTGCC GAGCCGACTA CGCGTTAAGT Cgacaatcaa 1621 cctctggatt acaaaatttg tgaaagatt