Construct: ORF TRCN0000489448
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019759.1_s317c1
- DNA Barcode:
- TTCGCTAATGTGAAGCACCGCCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR89B (51463)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489448
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 653519 | GPR89A | G protein-coupled receptor 89A | NM_001097612.2 | 99.9% | 99.7% | 1365_1366insG |
| 2 | human | 653519 | GPR89A | G protein-coupled receptor 89A | XM_006711492.4 | 99.9% | 99.7% | 1365_1366insG |
| 3 | human | 51463 | GPR89B | G protein-coupled receptor 89B | NM_001350180.1 | 99.8% | 99.7% | 12G>C;1365_1366insG |
| 4 | human | 51463 | GPR89B | G protein-coupled receptor 89B | NM_016334.5 | 99.8% | 99.7% | 12G>C;1365_1366insG |
| 5 | human | 653519 | GPR89A | G protein-coupled receptor 89A | NM_001097613.2 | 94.4% | 94.2% | 0_1ins75;1290_1291insG |
| 6 | human | 51463 | GPR89B | G protein-coupled receptor 89B | NM_001350181.1 | 94.4% | 94.2% | 0_1ins75;1290_1291insG |
| 7 | human | 51463 | GPR89B | G protein-coupled receptor 89B | NM_001350182.1 | 94.4% | 94.2% | 0_1ins75;1290_1291insG |
| 8 | human | 51463 | GPR89B | G protein-coupled receptor 89B | XM_005277402.4 | 94.4% | 94.2% | 0_1ins75;1290_1291insG |
| 9 | human | 653519 | GPR89A | G protein-coupled receptor 89A | XM_011509908.2 | 94.4% | 94.2% | 0_1ins75;1290_1291insG |
| 10 | human | 653519 | GPR89A | G protein-coupled receptor 89A | XM_011509909.2 | 94.4% | 94.2% | 0_1ins75;1290_1291insG |
| 11 | human | 51463 | GPR89B | G protein-coupled receptor 89B | XM_017001448.2 | 94.4% | 94.2% | 0_1ins75;1290_1291insG |
| 12 | human | 51463 | GPR89B | G protein-coupled receptor 89B | NM_001350183.1 | 73.5% | 73.4% | 0_1ins360;1005_1006insG |
| 13 | human | 51463 | GPR89B | G protein-coupled receptor 89B | NM_001350184.1 | 73.5% | 73.4% | 0_1ins360;1005_1006insG |
| 14 | human | 653519 | GPR89A | G protein-coupled receptor 89A | XM_006711493.3 | 73.5% | 73.4% | 0_1ins360;1005_1006insG |
| 15 | human | 51463 | GPR89B | G protein-coupled receptor 89B | XM_011509612.2 | 73.5% | 73.4% | 0_1ins360;1005_1006insG |
| 16 | human | 653519 | GPR89A | G protein-coupled receptor 89A | NR_036541.1 | 68.1% | 1_174del;488_507del;1560_2004delinsG | |
| 17 | human | 51463 | GPR89B | G protein-coupled receptor 89B | XR_001737221.1 | 62.3% | (many diffs) | |
| 18 | human | 653519 | GPR89A | G protein-coupled receptor 89A | XM_017002150.2 | 55.1% | 52.9% | (many diffs) |
| 19 | human | 51463 | GPR89B | G protein-coupled receptor 89B | XM_017001449.1 | 55% | 52.9% | (many diffs) |
| 20 | human | 653519 | GPR89A | G protein-coupled receptor 89A | XR_001737373.2 | 54.1% | 1_117del;845_941del;1580_2519delinsG | |
| 21 | human | 653519 | GPR89A | G protein-coupled receptor 89A | XM_011509910.3 | 53.7% | 53.5% | (many diffs) |
| 22 | human | 51463 | GPR89B | G protein-coupled receptor 89B | XM_011509613.2 | 53.6% | 53.5% | (many diffs) |
| 23 | mouse | 67549 | Gpr89 | G protein-coupled receptor 89 | NM_026229.4 | 88.3% | 96.7% | (many diffs) |
| 24 | mouse | 67549 | Gpr89 | G protein-coupled receptor 89 | XM_017319696.1 | 65% | 71% | (many diffs) |
| 25 | mouse | 67549 | Gpr89 | G protein-coupled receptor 89 | XR_375569.3 | 25.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1437
- ORF length:
- 1368
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gagtttcctc atcgactcca gcatcatgat tacctcccag atactatttt 121 ttggatttgg gtggcttttc ttcatgcgcc aattgtttaa agactatgag atacgtcagt 181 atgttgtaca ggtgatcttc tccgtgacgt ttgcattttc ttgcaccatg tttgagctca 241 tcatctttga aatcttagga gtattgaata gcagctcccg ttattttcac tggaaaatga 301 acctgtgtgt aattctgctg atcctggttt tcatggtgcc tttttacatt ggctatttta 361 ttgtgagcaa tatccgacta ctgcataaac aacgactgct tttttcctgt ctcttatggc 421 tgacctttat gtatttcttc tggaaactag gagatccctt tcccattctc agcccaaaac 481 atgggatctt atccatagaa cagctcatca gccgggttgg tgtgattgga gtgactctca 541 tggctcttct ttctggattt ggtgctgtca actgcccata cacttacatg tcttacttcc 601 tcaggaatgt gactgacacg gatattctag ccctggaacg gcgactgctg caaaccatgg 661 atatgatcat aagcaaaaag aaaaggatgg caatggcacg gagaacaatg ttccagaagg 721 gggaagtgca taacaaacca tcaggtttct ggggaatgat aaaaagtgtt accacttcag 781 catcaggaag tgaaaatctt actcttattc aacaggaagt ggatgctttg gaagaattaa 841 gcaggcagct ttttctggaa acagctgatc tatatgctac caaggagaga atagaatact 901 ccaaaacctt caaggggaaa tattttaatt ttcttggtta ctttttctct atttactgtg 961 tttggaaaat tttcatggct accatcaata ttgtttttga tcgagttggg aaaacggatc 1021 ctgtcacaag aggcattgag atcactgtga attatctggg aatccaattt gatgtgaagt 1081 tttggtccca acacatttcc ttcattcttg ttggaataaT CATCGTCACA TCCATCAGAG 1141 GATTGCTGAT CACTCTTACC AAGTTCTTTT ATGCCATCTC TAGCAGTAAG TCCTCCAATG 1201 TCATTGTCCT GCTATTAGCA CAGATAATGG GCATGTACTT TGTCTCCTCT GTGCTGCTGA 1261 TCCGAATGAG TATGCCTTTA GAATACCGCA CCATAATCAC TGAAGTCCTT GGAGAACTGC 1321 AGTTCAACTT CTATCACCGT TGGTTTGATG TGATCTTCCT GGTCAGCGCT CTCTCTAGCA 1381 TACTCTTCCT CTATTTGGCT CACAAACAGG CACCAGAGAA GCAAATGGCA CCTGACCCAG 1441 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1501 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1561 TATCTTGTGG AAAGGACGAT TCGCTAATGT GAAGCACCGC CCGACGCGTT AAGTCgacaa 1621 tcaacctctg gattacaaaa tttgtgaaag att