Transcript: Human XM_006711537.4

PREDICTED: Homo sapiens cell division cycle 73 (CDC73), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDC73 (79577)
Length:
1375
CDS:
170..1213

Additional Resources:

NCBI RefSeq record:
XM_006711537.4
NBCI Gene record:
CDC73 (79577)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711537.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011464 GCGTCAACATCGGCAAGTATA pLKO.1 473 CDS 100% 13.200 18.480 N CDC73 n/a
2 TRCN0000008731 GCTGCCTATAACAGATACGAT pLKO.1 1031 CDS 100% 3.000 4.200 N CDC73 n/a
3 TRCN0000175932 GCGCCTTGATAAAGAGAGATT pLKO.1 607 CDS 100% 4.950 3.960 N Cdc73 n/a
4 TRCN0000008730 GCTCCCTTAGAAATAGGTCTT pLKO.1 503 CDS 100% 4.050 3.240 N CDC73 n/a
5 TRCN0000329742 ATGACATAACTGCCCTTAAAC pLKO_005 777 CDS 100% 13.200 9.240 N CDC73 n/a
6 TRCN0000329680 ACTGAACAGATTAGGTCTTTG pLKO_005 668 CDS 100% 10.800 7.560 N CDC73 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711537.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04081 pDONR223 100% 63.8% 61.2% None (many diffs) n/a
2 ccsbBroad304_04081 pLX_304 0% 63.8% 61.2% V5 (many diffs) n/a
3 TRCN0000469280 TCCTCTACACAGTTGTTGGGCCGT pLX_317 14.5% 63.8% 61.2% V5 (many diffs) n/a
4 ccsbBroadEn_12569 pDONR223 100% 30.8% 28.4% None (many diffs) n/a
5 ccsbBroad304_12569 pLX_304 0% 30.8% 28.4% V5 (many diffs) n/a
6 TRCN0000473561 CGAAATTGACGTATAGCATAATCT pLX_317 20.1% 30.8% 28.4% V5 (many diffs) n/a
Download CSV