Transcript: Human XM_006712109.2

PREDICTED: Homo sapiens transcription factor 7 like 1 (TCF7L1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCF7L1 (83439)
Length:
2710
CDS:
16..1785

Additional Resources:

NCBI RefSeq record:
XM_006712109.2
NBCI Gene record:
TCF7L1 (83439)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712109.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232678 TCCAGCACACTTGTCTAATAA pLKO_005 528 CDS 100% 15.000 21.000 N TCF7L1 n/a
2 TRCN0000232679 ATCCGAGCTGTCACCGTATTA pLKO_005 699 CDS 100% 13.200 18.480 N TCF7L1 n/a
3 TRCN0000232680 CATGACTCATTGAGTAGTAAT pLKO_005 1813 3UTR 100% 13.200 18.480 N TCF7L1 n/a
4 TRCN0000021705 CCAGCACACTTGTCTAATAAA pLKO.1 529 CDS 100% 15.000 10.500 N TCF7L1 n/a
5 TRCN0000257347 CTCAGGACAGCGCGTTCTTTA pLKO_005 338 CDS 100% 13.200 9.240 N TCF7L1 n/a
6 TRCN0000095457 GAAGGAAAGTGCAGCCATTAA pLKO.1 1128 CDS 100% 13.200 9.240 N Tcf7l1 n/a
7 TRCN0000232677 GCACCTACCTGCAGATGAAAT pLKO_005 452 CDS 100% 13.200 9.240 N TCF7L1 n/a
8 TRCN0000021707 TGAAGGAAAGTGCAGCCATTA pLKO.1 1127 CDS 100% 10.800 7.560 N TCF7L1 n/a
9 TRCN0000021704 CGGGACAACTATGGTAAGAAA pLKO.1 1264 CDS 100% 5.625 3.938 N TCF7L1 n/a
10 TRCN0000021706 CCTTGGAAGAAAGTGGCACAA pLKO.1 1155 CDS 100% 4.050 2.835 N TCF7L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712109.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12735 pDONR223 100% 99.6% 99.4% None 22_24delGGC;656_658delCAG;1600G>A n/a
2 ccsbBroad304_12735 pLX_304 0% 99.6% 99.4% V5 22_24delGGC;656_658delCAG;1600G>A n/a
3 TRCN0000476823 GGTCTGTTTCACTGTGTGTTTTTA pLX_317 12.3% 99.6% 99.4% V5 22_24delGGC;656_658delCAG;1600G>A n/a
Download CSV