Transcript: Human XM_006712243.2

PREDICTED: Homo sapiens cyclic nucleotide gated channel subunit alpha 3 (CNGA3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNGA3 (1261)
Length:
4479
CDS:
385..2580

Additional Resources:

NCBI RefSeq record:
XM_006712243.2
NBCI Gene record:
CNGA3 (1261)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044202 CCTGATGAAAGACAACCTGAT pLKO.1 2310 CDS 100% 4.050 5.670 N CNGA3 n/a
2 TRCN0000044201 CAAGGCTTAATGGTCAGTGAT pLKO.1 1180 CDS 100% 4.950 3.465 N CNGA3 n/a
3 TRCN0000044198 CCCGTGAAAGATGAGGAGTAT pLKO.1 1609 CDS 100% 4.950 3.465 N CNGA3 n/a
4 TRCN0000044200 CCTGTCTTCTATAACTGGTAT pLKO.1 1027 CDS 100% 4.950 3.465 N CNGA3 n/a
5 TRCN0000044199 GCCTGCATCTACTTTGCCATT pLKO.1 1447 CDS 100% 4.050 2.835 N CNGA3 n/a
6 TRCN0000417244 AGACAGTTTGAGGCATATTTC pLKO_005 3052 3UTR 100% 13.200 7.920 N CNGA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00336 pDONR223 100% 90.2% 90.1% None 213_377del;560_561ins54 n/a
2 ccsbBroad304_00336 pLX_304 0% 90.2% 90.1% V5 213_377del;560_561ins54 n/a
3 TRCN0000467965 CAGTAAACTGGAACATCCGATTTC pLX_317 15.7% 90.2% 90.1% V5 213_377del;560_561ins54 n/a
Download CSV