Transcript: Human XM_006712740.1

PREDICTED: Homo sapiens melanophilin (MLPH), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MLPH (79083)
Length:
2214
CDS:
212..1810

Additional Resources:

NCBI RefSeq record:
XM_006712740.1
NBCI Gene record:
MLPH (79083)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128005 GATCGGAAATCAGTGTACCGA pLKO.1 1703 CDS 100% 0.750 1.050 N MLPH n/a
2 TRCN0000318998 GATCGGAAATCAGTGTACCGA pLKO_005 1703 CDS 100% 0.750 1.050 N MLPH n/a
3 TRCN0000127661 CAGTACAACAGGACCACAGAT pLKO.1 1364 CDS 100% 4.950 3.960 N MLPH n/a
4 TRCN0000128222 CCTTTAGGACAATGTTGTGTA pLKO.1 2073 3UTR 100% 4.950 3.960 N MLPH n/a
5 TRCN0000319000 CCTTTAGGACAATGTTGTGTA pLKO_005 2073 3UTR 100% 4.950 3.960 N MLPH n/a
6 TRCN0000128702 CTGATCTGTGAGAAACAGCTA pLKO.1 2037 3UTR 100% 2.640 1.584 N MLPH n/a
7 TRCN0000319073 CTGATCTGTGAGAAACAGCTA pLKO_005 2037 3UTR 100% 2.640 1.584 N MLPH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04044 pDONR223 100% 93% 93% None 555_556ins120 n/a
2 ccsbBroad304_04044 pLX_304 0% 93% 93% V5 555_556ins120 n/a
3 TRCN0000467668 CGAGCACGGACTCTCTCACACTCG pLX_317 22.5% 93% 93% V5 555_556ins120 n/a
4 ccsbBroadEn_04043 pDONR223 100% 88.6% 88.6% None 555_556ins120;898_899ins84 n/a
5 ccsbBroad304_04043 pLX_304 0% 88.6% 88.6% V5 555_556ins120;898_899ins84 n/a
6 TRCN0000479827 CCTACAGCTACGCAATGAGCTCCC pLX_317 21.5% 88.6% 88.6% V5 555_556ins120;898_899ins84 n/a
Download CSV