Transcript: Human XM_006712980.4

PREDICTED: Homo sapiens leucine rich single-pass membrane protein 2 (LSMEM2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LSMEM2 (132228)
Length:
1969
CDS:
537..1055

Additional Resources:

NCBI RefSeq record:
XM_006712980.4
NBCI Gene record:
LSMEM2 (132228)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712980.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161371 GCTGACCGTTCTGTTTAATTA pLKO.1 1600 3UTR 100% 15.000 21.000 N LSMEM2 n/a
2 TRCN0000165221 GACACTACTCAAACTCCGCTT pLKO.1 977 CDS 100% 2.160 3.024 N LSMEM2 n/a
3 TRCN0000166373 CCCTGAGGAAGGCACATATTT pLKO.1 1796 3UTR 100% 15.000 10.500 N LSMEM2 n/a
4 TRCN0000163789 GCTGCCACATCTACACTATTT pLKO.1 1141 3UTR 100% 13.200 9.240 N LSMEM2 n/a
5 TRCN0000163631 GCAGGTTCTGAAGTCTAGAAA pLKO.1 1354 3UTR 100% 5.625 3.938 N LSMEM2 n/a
6 TRCN0000162371 CACTATTTCCTTGGTGAGATT pLKO.1 1154 3UTR 100% 4.950 3.465 N LSMEM2 n/a
7 TRCN0000166234 CAGGAGGAGACACTACTCAAA pLKO.1 969 CDS 100% 4.950 3.465 N LSMEM2 n/a
8 TRCN0000165705 CCCATAGCAATCACCCAAACT pLKO.1 1383 3UTR 100% 4.950 3.465 N LSMEM2 n/a
9 TRCN0000164908 GAGGAGACACTACTCAAACTC pLKO.1 972 CDS 100% 4.950 3.465 N LSMEM2 n/a
10 TRCN0000165352 GATGGCAGGTTCTGAAGTCTA pLKO.1 1350 3UTR 100% 4.950 3.465 N LSMEM2 n/a
11 TRCN0000163318 GAGAAAGGAAAGGAAGGGAAA pLKO.1 1751 3UTR 100% 4.050 2.025 Y LSMEM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712980.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04880 pDONR223 100% 86.7% 83.7% None (many diffs) n/a
2 ccsbBroad304_04880 pLX_304 0% 86.7% 83.7% V5 (many diffs) n/a
3 TRCN0000478319 CCTGGCCTTGTAGCACGTATTTCC pLX_317 66.9% 86.7% 83.7% V5 (many diffs) n/a
Download CSV