Transcript: Human XM_006714259.4

PREDICTED: Homo sapiens septin 11 (SEPTIN11), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEPTIN11 (55752)
Length:
5280
CDS:
228..1346

Additional Resources:

NCBI RefSeq record:
XM_006714259.4
NBCI Gene record:
SEPTIN11 (55752)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714259.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163209 GTACGGCTGAAGTTAACCATT pLKO.1 330 CDS 100% 4.950 6.930 N SEPTIN11 n/a
2 TRCN0000281068 GTACGGCTGAAGTTAACCATT pLKO_005 330 CDS 100% 4.950 6.930 N SEPTIN11 n/a
3 TRCN0000163126 GATTGGCAACAAGATGGCAAA pLKO.1 788 CDS 100% 4.050 5.670 N SEPTIN11 n/a
4 TRCN0000163329 CGGCTGAAGTTAACCATTGTT pLKO.1 333 CDS 100% 5.625 4.500 N SEPTIN11 n/a
5 TRCN0000160602 CCTTTCAGTATTTGGCAATAA pLKO.1 2455 3UTR 100% 13.200 9.240 N SEPTIN11 n/a
6 TRCN0000159716 GCAAGAGGAATTGAAGATTAA pLKO.1 443 CDS 100% 13.200 9.240 N SEPTIN11 n/a
7 TRCN0000281067 GCAAGAGGAATTGAAGATTAA pLKO_005 443 CDS 100% 13.200 9.240 N SEPTIN11 n/a
8 TRCN0000162495 CACGTTAATGGACACTTTGTT pLKO.1 221 5UTR 100% 5.625 3.938 N SEPTIN11 n/a
9 TRCN0000281003 CACGTTAATGGACACTTTGTT pLKO_005 221 5UTR 100% 5.625 3.938 N SEPTIN11 n/a
10 TRCN0000112986 GCACAAATTCAAGAGTAAGAT pLKO.1 635 CDS 100% 5.625 3.938 N Sept11 n/a
11 TRCN0000159372 GCACAAATTCAAGAGTAAGAT pLKO.1 635 CDS 100% 5.625 3.938 N SEPTIN11 n/a
12 TRCN0000281001 GCACAAATTCAAGAGTAAGAT pLKO_005 635 CDS 100% 5.625 3.938 N SEPTIN11 n/a
13 TRCN0000326491 GCACAAATTCAAGAGTAAGAT pLKO_005 635 CDS 100% 5.625 3.938 N Sept11 n/a
14 TRCN0000165270 GCTGACACCATTGCCAAGAAT pLKO.1 609 CDS 100% 5.625 3.938 N SEPTIN11 n/a
15 TRCN0000281000 GCTGACACCATTGCCAAGAAT pLKO_005 609 CDS 100% 5.625 3.938 N SEPTIN11 n/a
16 TRCN0000164551 CCAGCAAACCAAGAAAGACAA pLKO.1 1298 CDS 100% 4.950 3.465 N SEPTIN11 n/a
17 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3934 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714259.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03648 pDONR223 100% 86.7% 86.7% None 0_1ins171 n/a
2 ccsbBroad304_03648 pLX_304 0% 86.7% 86.7% V5 0_1ins171 n/a
3 TRCN0000476830 ATAGCAGCTAGTCCCGCTTTCCTT pLX_317 31.4% 86.7% 86.7% V5 0_1ins171 n/a
Download CSV