Transcript: Human XM_006714732.1

PREDICTED: Homo sapiens neuronal regeneration related protein (NREP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NREP (9315)
Length:
1916
CDS:
17..298

Additional Resources:

NCBI RefSeq record:
XM_006714732.1
NBCI Gene record:
NREP (9315)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322722 TAATCGTAACACCTCCATTTG pLKO_005 296 CDS 100% 10.800 15.120 N NREP n/a
2 TRCN0000136334 GCCTGAGTTTCTTGTGCATTA pLKO.1 1673 3UTR 100% 10.800 7.560 N NREP n/a
3 TRCN0000322778 GCCTGAGTTTCTTGTGCATTA pLKO_005 1673 3UTR 100% 10.800 7.560 N NREP n/a
4 TRCN0000134967 CCCAACGAAATGGATAAACAA pLKO.1 1461 3UTR 100% 5.625 3.938 N NREP n/a
5 TRCN0000134039 CAAGAACCATTTCCAAACAAG pLKO.1 128 CDS 100% 4.950 3.465 N NREP n/a
6 TRCN0000133785 CAAGAAGAACGATGAGACAAA pLKO.1 205 CDS 100% 4.950 3.465 N NREP n/a
7 TRCN0000135903 GCAAGAAGAACGATGAGACAA pLKO.1 204 CDS 100% 4.950 3.465 N NREP n/a
8 TRCN0000370233 ACCATTTCCAAACAAGGACAT pLKO_005 133 CDS 100% 4.050 2.835 N NREP n/a
9 TRCN0000322721 CCGCAAGAAGAACGATGAGAC pLKO_005 202 CDS 100% 4.050 2.835 N NREP n/a
10 TRCN0000370232 CCTGTCCCAAAGGAAGTGAAC pLKO_005 182 CDS 100% 4.050 2.835 N NREP n/a
11 TRCN0000370231 CAAGAATCAGTTACCTCCACT pLKO_005 270 CDS 100% 2.640 1.848 N NREP n/a
12 TRCN0000322779 TCCTAAGGGAAGACTTCCTGT pLKO_005 166 CDS 100% 2.640 1.848 N NREP n/a
13 TRCN0000135745 CCATTTCCAAACAAGGACATG pLKO.1 134 CDS 100% 4.050 2.430 N NREP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02134 pDONR223 100% 72.7% 72% None 1_73delinsA;76_78delTCT n/a
2 ccsbBroad304_02134 pLX_304 0% 72.7% 72% V5 1_73delinsA;76_78delTCT n/a
3 TRCN0000470347 GATTTCGACCCTGGACTCATTCAA pLX_317 100% 72.7% 72% V5 1_73delinsA;76_78delTCT n/a
Download CSV