Transcript: Human XM_006714879.3

PREDICTED: Homo sapiens family with sequence similarity 193 member B (FAM193B), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM193B (54540)
Length:
2938
CDS:
175..2544

Additional Resources:

NCBI RefSeq record:
XM_006714879.3
NBCI Gene record:
FAM193B (54540)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714879.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271344 TGCCAGCTGAAGGCGTATAAT pLKO_005 2591 3UTR 100% 15.000 21.000 N FAM193B n/a
2 TRCN0000271405 CTCGTTCCTGTCGGCACATAA pLKO_005 423 CDS 100% 13.200 9.240 N FAM193B n/a
3 TRCN0000062445 GAAGCTCTAAAGCAGGCAAAT pLKO.1 1378 CDS 100% 10.800 7.560 N FAM193B n/a
4 TRCN0000271406 TGTCACACACATCCTGCAAAT pLKO_005 296 CDS 100% 10.800 7.560 N FAM193B n/a
5 TRCN0000062447 GTCCTAGAGCTTCCCAAAGTA pLKO.1 2104 CDS 100% 5.625 3.938 N FAM193B n/a
6 TRCN0000062446 GCAAAGCAGACTCGTCAGAAA pLKO.1 2464 CDS 100% 4.950 3.465 N FAM193B n/a
7 TRCN0000062444 GTACTTTAAGAGGTTCTGTTT pLKO.1 2436 CDS 100% 4.950 3.465 N FAM193B n/a
8 TRCN0000062443 GCTCAAAGGAAGTTCCCAGTT pLKO.1 1913 CDS 100% 4.050 2.835 N FAM193B n/a
9 TRCN0000271345 TTGTGGAGATGACTCTCATTC pLKO_005 324 CDS 100% 10.800 6.480 N FAM193B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714879.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10509 pDONR223 100% 56.6% 56.5% None 1_1023del;1029G>N;2107T>C n/a
2 TRCN0000466772 TCCTCTCACTTCAGCGTTTAGCAG pLX_317 29.5% 56.6% 56.5% V5 1_1023del;1029G>N;2107T>C n/a
Download CSV