Transcript: Human XM_006714885.1

PREDICTED: Homo sapiens family with sequence similarity 193 member B (FAM193B), transcript variant X19, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM193B (54540)
Length:
2043
CDS:
303..1649

Additional Resources:

NCBI RefSeq record:
XM_006714885.1
NBCI Gene record:
FAM193B (54540)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714885.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271344 TGCCAGCTGAAGGCGTATAAT pLKO_005 1696 3UTR 100% 15.000 21.000 N FAM193B n/a
2 TRCN0000062445 GAAGCTCTAAAGCAGGCAAAT pLKO.1 483 CDS 100% 10.800 7.560 N FAM193B n/a
3 TRCN0000062447 GTCCTAGAGCTTCCCAAAGTA pLKO.1 1209 CDS 100% 5.625 3.938 N FAM193B n/a
4 TRCN0000062446 GCAAAGCAGACTCGTCAGAAA pLKO.1 1569 CDS 100% 4.950 3.465 N FAM193B n/a
5 TRCN0000062444 GTACTTTAAGAGGTTCTGTTT pLKO.1 1541 CDS 100% 4.950 3.465 N FAM193B n/a
6 TRCN0000062443 GCTCAAAGGAAGTTCCCAGTT pLKO.1 1018 CDS 100% 4.050 2.835 N FAM193B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714885.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10509 pDONR223 100% 99.8% 99.5% None 6G>N;1084T>C n/a
2 TRCN0000466772 TCCTCTCACTTCAGCGTTTAGCAG pLX_317 29.5% 99.8% 99.5% V5 6G>N;1084T>C n/a
Download CSV