Transcript: Human XM_006715237.3

PREDICTED: Homo sapiens receptor interacting serine/threonine kinase 1 (RIPK1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RIPK1 (8737)
Length:
1321
CDS:
156..1226

Additional Resources:

NCBI RefSeq record:
XM_006715237.3
NBCI Gene record:
RIPK1 (8737)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715237.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197069 GTAGTACTCTGGGCGATATTT pLKO.1 801 CDS 100% 15.000 21.000 N RIPK1 n/a
2 TRCN0000000708 CCTTGTTGATAATGACTTCCA pLKO.1 587 CDS 100% 2.640 2.112 N RIPK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715237.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroad304_14910 pLX_304 42% 59.5% 68.9% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14910 pDONR223 82.3% 50% 68.9% None (many diffs) n/a
3 TRCN0000480391 GTAAAGCGGTTGTCTCGACGCCAA pLX_317 19.1% 50% 68.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV