Transcript: Human XM_006715241.3

PREDICTED: Homo sapiens ring finger protein 8 (RNF8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF8 (9025)
Length:
2002
CDS:
151..1518

Additional Resources:

NCBI RefSeq record:
XM_006715241.3
NBCI Gene record:
RNF8 (9025)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715241.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293325 TACATGTCGAAAGAGTTATTT pLKO_005 1771 3UTR 100% 15.000 21.000 N RNF8 n/a
2 TRCN0000293324 TGGAACCTTTAAGGGTCTATT pLKO_005 425 CDS 100% 13.200 18.480 N RNF8 n/a
3 TRCN0000003441 CCAAAGAATGACCAAATGATA pLKO.1 562 CDS 100% 5.625 3.938 N RNF8 n/a
4 TRCN0000298501 CCAAAGAATGACCAAATGATA pLKO_005 562 CDS 100% 5.625 3.938 N RNF8 n/a
5 TRCN0000003438 TGGAGCAACTAGAGAAGACTT pLKO.1 1079 CDS 100% 4.950 3.465 N RNF8 n/a
6 TRCN0000293306 TGGAGCAACTAGAGAAGACTT pLKO_005 1079 CDS 100% 4.950 3.465 N RNF8 n/a
7 TRCN0000003439 GAAGCCGTTATGAATGTGAAA pLKO.1 952 CDS 100% 4.950 2.970 N RNF8 n/a
8 TRCN0000293390 GAAGCCGTTATGAATGTGAAA pLKO_005 952 CDS 100% 4.950 2.970 N RNF8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715241.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07340 pDONR223 100% 93.7% 93.8% None 1036_1037ins90;1254G>A n/a
2 ccsbBroad304_07340 pLX_304 0% 93.7% 93.8% V5 1036_1037ins90;1254G>A n/a
3 TRCN0000467155 CCCTCTGAGTGTACCATCTCGAAG pLX_317 25.9% 93.7% 93.8% V5 1036_1037ins90;1254G>A n/a
Download CSV