Transcript: Human XM_006715578.3

PREDICTED: Homo sapiens L3MBTL histone methyl-lysine binding protein 3 (L3MBTL3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
L3MBTL3 (84456)
Length:
4190
CDS:
161..2503

Additional Resources:

NCBI RefSeq record:
XM_006715578.3
NBCI Gene record:
L3MBTL3 (84456)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715578.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431896 CAATCGTTTCCTGGTACATTT pLKO_005 1354 CDS 100% 13.200 18.480 N L3MBTL3 n/a
2 TRCN0000436283 GTCGAAACCTGGCTAAGTTTA pLKO_005 2936 3UTR 100% 13.200 18.480 N L3MBTL3 n/a
3 TRCN0000151610 GTCCGTCATTTCCAAGAAATA pLKO.1 1983 CDS 100% 13.200 10.560 N L3MBTL3 n/a
4 TRCN0000431599 AGCTGCTCCTAAGTCATTATT pLKO_005 1216 CDS 100% 15.000 10.500 N L3MBTL3 n/a
5 TRCN0000424756 CAAAGCACAAGGACGGTTATA pLKO_005 2558 3UTR 100% 13.200 9.240 N L3MBTL3 n/a
6 TRCN0000417887 GAACATAGAAGAACCCTTATT pLKO_005 1451 CDS 100% 13.200 9.240 N L3MBTL3 n/a
7 TRCN0000438461 CACAGATGATCACCGGGTAAA pLKO_005 1657 CDS 100% 10.800 7.560 N L3MBTL3 n/a
8 TRCN0000435513 GGATGAGAGCTATGACTATTG pLKO_005 1384 CDS 100% 10.800 7.560 N L3MBTL3 n/a
9 TRCN0000152202 CCAGGAAGTGACTTAAAGTTT pLKO.1 245 CDS 100% 5.625 3.938 N L3MBTL3 n/a
10 TRCN0000151903 CCTTTGCATTTGCCAATTCAA pLKO.1 4000 3UTR 100% 5.625 3.938 N L3MBTL3 n/a
11 TRCN0000151954 CGGCACATCAAAGATAAAGAT pLKO.1 593 CDS 100% 5.625 3.938 N L3MBTL3 n/a
12 TRCN0000151391 GCTGGAACAATTGCTATGATT pLKO.1 1692 CDS 100% 5.625 3.938 N L3MBTL3 n/a
13 TRCN0000150657 GTAACAGATATGGTGGACAAT pLKO.1 1337 CDS 100% 4.950 3.465 N L3MBTL3 n/a
14 TRCN0000154351 CAGAACATGGTGGATGCTCAA pLKO.1 1818 CDS 100% 4.050 2.835 N L3MBTL3 n/a
15 TRCN0000154332 CCCTTATTACTCCACCAGGTT pLKO.1 1464 CDS 100% 2.640 1.848 N L3MBTL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715578.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09192 pDONR223 100% 96.7% 96.6% None 213_287del;548C>A;825T>C n/a
2 ccsbBroad304_09192 pLX_304 0% 96.7% 96.6% V5 213_287del;548C>A;825T>C n/a
3 TRCN0000469035 ACTACTTCGTCCCCATCTCTGACC pLX_317 20.5% 96.7% 96.6% V5 213_287del;548C>A;825T>C n/a
Download CSV