Transcript: Human XM_006715786.3

PREDICTED: Homo sapiens CCM2 scaffold protein (CCM2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCM2 (83605)
Length:
2214
CDS:
680..1804

Additional Resources:

NCBI RefSeq record:
XM_006715786.3
NBCI Gene record:
CCM2 (83605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715786.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083234 CCTGGAATTGTCTCGCCATTT pLKO.1 773 CDS 100% 10.800 8.640 N CCM2 n/a
2 TRCN0000083236 CTATATTGAGAAGGAGGTAAA pLKO.1 925 CDS 100% 10.800 8.640 N CCM2 n/a
3 TRCN0000421246 CACACTGTGGTGTTGTCATTG pLKO_005 869 CDS 100% 10.800 7.560 N CCM2 n/a
4 TRCN0000437822 TCGGACATCAGCAGCGACATT pLKO_005 1745 CDS 100% 4.950 3.465 N CCM2 n/a
5 TRCN0000083233 GCCCAGGTCCTCTACTGTGAA pLKO.1 1939 3UTR 100% 1.650 1.155 N CCM2 n/a
6 TRCN0000083235 GCATTTCATAGACAATGCAAA pLKO.1 1009 CDS 100% 0.495 0.347 N CCM2 n/a
7 TRCN0000083237 GCTGAGCGACTATATTGAGAA pLKO.1 916 CDS 100% 4.950 2.970 N CCM2 n/a
8 TRCN0000198459 GCTGAGCGACTATATTGAGAA pLKO.1 916 CDS 100% 4.950 2.970 N Ccm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715786.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04281 pDONR223 100% 75.6% 73.4% None (many diffs) n/a
2 ccsbBroad304_04281 pLX_304 0% 75.6% 73.4% V5 (many diffs) n/a
3 TRCN0000469977 AAGTACGCAATTACATCCAACGAA pLX_317 25.2% 75.6% 73.4% V5 (many diffs) n/a
4 ccsbBroadEn_12745 pDONR223 100% 18.5% 16% None (many diffs) n/a
5 ccsbBroad304_12745 pLX_304 0% 18.5% 16% V5 (many diffs) n/a
6 TRCN0000470550 AGCGCGAAGTGTATTCCTACTCGG pLX_317 100% 18.5% 16% V5 (many diffs) n/a
Download CSV