Transcript: Human XM_006715831.4

PREDICTED: Homo sapiens solute carrier family 25 member 13 (SLC25A13), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC25A13 (10165)
Length:
3127
CDS:
96..2156

Additional Resources:

NCBI RefSeq record:
XM_006715831.4
NBCI Gene record:
SLC25A13 (10165)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715831.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044068 GCGGAGTGATAGACTGCTTTA pLKO.1 1807 CDS 100% 10.800 15.120 N SLC25A13 n/a
2 TRCN0000310608 GCGGAGTGATAGACTGCTTTA pLKO_005 1807 CDS 100% 10.800 15.120 N SLC25A13 n/a
3 TRCN0000069207 CCTTAACAACATGGAACTCAT pLKO.1 806 CDS 100% 4.950 6.930 N Slc25a13 n/a
4 TRCN0000303087 CCTTAACAACATGGAACTCAT pLKO_005 806 CDS 100% 4.950 6.930 N Slc25a13 n/a
5 TRCN0000044071 CCAATGACTTTGTCACTCGAT pLKO.1 238 CDS 100% 2.640 3.696 N SLC25A13 n/a
6 TRCN0000310607 CCAATGACTTTGTCACTCGAT pLKO_005 238 CDS 100% 2.640 3.696 N SLC25A13 n/a
7 TRCN0000044070 CCAACGATCAACTGGCTCTTT pLKO.1 1202 CDS 100% 4.950 3.465 N SLC25A13 n/a
8 TRCN0000300322 CCAACGATCAACTGGCTCTTT pLKO_005 1202 CDS 100% 4.950 3.465 N SLC25A13 n/a
9 TRCN0000044069 GCCATCTACTTTCCGTGCTAT pLKO.1 1620 CDS 100% 4.950 3.465 N SLC25A13 n/a
10 TRCN0000300276 GCCATCTACTTTCCGTGCTAT pLKO_005 1620 CDS 100% 4.950 3.465 N SLC25A13 n/a
11 TRCN0000044072 GCTTTGTTTATGGTAGCCTTT pLKO.1 396 CDS 100% 4.050 2.835 N SLC25A13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715831.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02337 pDONR223 100% 98% 97.6% None (many diffs) n/a
2 ccsbBroad304_02337 pLX_304 0% 98% 97.6% V5 (many diffs) n/a
3 TRCN0000473084 ACTTCGGTATTTTCCGCTAAGGTC pLX_317 17.9% 98% 97.6% V5 (many diffs) n/a
Download CSV