Transcript: Human XM_006717914.3

PREDICTED: Homo sapiens protein phosphatase 2 regulatory subunit Bdelta (PPP2R2D), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP2R2D (55844)
Length:
3206
CDS:
216..1325

Additional Resources:

NCBI RefSeq record:
XM_006717914.3
NBCI Gene record:
PPP2R2D (55844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717914.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307979 TGGCCGAAGCGGACATCATTT pLKO_005 307 CDS 100% 13.200 18.480 N PPP2R2D n/a
2 TRCN0000379969 TTGCTGGAACGGTTCGGATAG pLKO_005 1277 CDS 100% 6.000 8.400 N PPP2R2D n/a
3 TRCN0000381008 TATAACCTGAAAGACGAAGAT pLKO_005 633 CDS 100% 4.950 3.960 N PPP2R2D n/a
4 TRCN0000295837 ATGCTCACACATATCATATAA pLKO_005 754 CDS 100% 15.000 10.500 N PPP2R2D n/a
5 TRCN0000295889 GCAGATGACCTGAGAATTAAT pLKO_005 816 CDS 100% 15.000 10.500 N PPP2R2D n/a
6 TRCN0000063710 GTCCTTCTTCTCAGAAATAAT pLKO.1 1067 CDS 100% 15.000 10.500 N PPP2R2D n/a
7 TRCN0000288615 GTCCTTCTTCTCAGAAATAAT pLKO_005 1067 CDS 100% 15.000 10.500 N PPP2R2D n/a
8 TRCN0000179677 GCACCTTTCAAAGTCATGAAC pLKO.1 457 CDS 100% 4.950 3.465 N PPP2R2D n/a
9 TRCN0000063709 GCTCTGCTCTCTCTATGAGAA pLKO.1 1229 CDS 100% 4.950 3.465 N PPP2R2D n/a
10 TRCN0000178853 CTTTCAAAGTCATGAACCGGA pLKO.1 461 CDS 100% 0.660 0.462 N PPP2R2D n/a
11 TRCN0000380734 ATCACAGATAGAAGCTTTAAC pLKO_005 852 CDS 100% 13.200 7.920 N PPP2R2D n/a
12 TRCN0000430828 ATAGTGATCATGAAACATATC pLKO_005 790 CDS 100% 10.800 6.480 N Ppp2r2d n/a
13 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1597 3UTR 100% 4.950 2.475 Y ERAP2 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1598 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717914.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03663 pDONR223 100% 80.4% 79.6% None (many diffs) n/a
2 ccsbBroad304_03663 pLX_304 0% 80.4% 79.6% V5 (many diffs) n/a
3 TRCN0000469793 TATCGACAATACAATTAAAATGTG pLX_317 25.5% 80.4% 79.6% V5 (many diffs) n/a
Download CSV