Transcript: Human XM_006718030.1

PREDICTED: Homo sapiens polycomb group ring finger 5 (PCGF5), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCGF5 (84333)
Length:
7068
CDS:
545..1120

Additional Resources:

NCBI RefSeq record:
XM_006718030.1
NBCI Gene record:
PCGF5 (84333)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006718030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222589 CGTGTAACTGTGGGAACTATT pLKO.1 857 CDS 100% 13.200 10.560 N PCGF5 n/a
2 TRCN0000073115 GTATCGACCAAGAATTGATTT pLKO.1 1093 CDS 100% 13.200 10.560 N PCGF5 n/a
3 TRCN0000295823 CAATGTAGTAAAGGGTTTAAT pLKO_005 811 CDS 100% 15.000 10.500 N PCGF5 n/a
4 TRCN0000095162 GCTGTGCAATGGTGAAATTAT pLKO.1 931 CDS 100% 15.000 10.500 N Pcgf5 n/a
5 TRCN0000295879 TGCTGTGCAATGGTGAAATTA pLKO_005 930 CDS 100% 15.000 10.500 N PCGF5 n/a
6 TRCN0000295826 CCTTACATTACCTGCTATATC pLKO_005 486 5UTR 100% 13.200 9.240 N PCGF5 n/a
7 TRCN0000073117 CCACAAATTGCTATCTGTCTA pLKO.1 758 CDS 100% 4.950 3.465 N PCGF5 n/a
8 TRCN0000073113 GCCATGATTCACCCTTCTGAA pLKO.1 1390 3UTR 100% 4.950 3.465 N PCGF5 n/a
9 TRCN0000288668 GCCATGATTCACCCTTCTGAA pLKO_005 1390 3UTR 100% 4.950 3.465 N PCGF5 n/a
10 TRCN0000073116 GAAGGATCATACTATGGAATT pLKO.1 955 CDS 100% 0.000 0.000 N PCGF5 n/a
11 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 5065 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 5065 3UTR 100% 4.050 2.025 Y ORAI2 n/a
13 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 5065 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000095161 GCAATGGTGAAATTATGGGAA pLKO.1 936 CDS 100% 2.640 1.848 N Pcgf5 n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5027 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006718030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04383 pDONR223 100% 74.6% 72.6% None 0_1ins98;14_15ins97 n/a
2 ccsbBroad304_04383 pLX_304 0% 74.6% 72.6% V5 0_1ins98;14_15ins97 n/a
3 TRCN0000468078 AGGTCGGTCCTAGCCACCAGCTCA pLX_317 61.8% 74.6% 72.6% V5 0_1ins98;14_15ins97 n/a
Download CSV