Transcript: Human XM_006718716.3

PREDICTED: Homo sapiens PTPRF interacting protein alpha 1 (PPFIA1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPFIA1 (8500)
Length:
5559
CDS:
229..4149

Additional Resources:

NCBI RefSeq record:
XM_006718716.3
NBCI Gene record:
PPFIA1 (8500)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006718716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380097 GGTGTTTCCGAGACGGATAAC pLKO_005 2941 CDS 100% 10.800 15.120 N PPFIA1 n/a
2 TRCN0000342461 TGAGCCTTCCAAGGTACAAAC pLKO_005 1998 CDS 100% 10.800 15.120 N PPFIA1 n/a
3 TRCN0000342517 GAGTTCGCAGCACTTACTAAA pLKO_005 493 CDS 100% 13.200 10.560 N PPFIA1 n/a
4 TRCN0000380570 AGATCTTCTGATGGTTCTTTA pLKO_005 937 CDS 100% 13.200 9.240 N PPFIA1 n/a
5 TRCN0000342516 GATGACAAGACAACCATAAAG pLKO_005 2641 CDS 100% 13.200 9.240 N PPFIA1 n/a
6 TRCN0000380824 AGCCATGTGCATTATCCTTTA pLKO_005 4607 3UTR 100% 10.800 7.560 N PPFIA1 n/a
7 TRCN0000002971 GCACAGTTGGAGGAGAAGAAT pLKO.1 1564 CDS 100% 5.625 3.938 N PPFIA1 n/a
8 TRCN0000002968 GCTCCAAGAAATCATAAGTAA pLKO.1 990 CDS 100% 5.625 3.938 N PPFIA1 n/a
9 TRCN0000002970 GCATATTAACAAGCCAGCAAA pLKO.1 5286 3UTR 100% 4.950 3.465 N PPFIA1 n/a
10 TRCN0000002967 GTAGTTTGTTAGAAGAGGAAT pLKO.1 794 CDS 100% 4.950 3.465 N PPFIA1 n/a
11 TRCN0000002969 GAGGAGATTGAAAGTCGAGTT pLKO.1 2275 CDS 100% 4.050 2.835 N PPFIA1 n/a
12 TRCN0000342514 GAGGAGATTGAAAGTCGAGTT pLKO_005 2275 CDS 100% 4.050 2.835 N PPFIA1 n/a
13 TRCN0000251544 ATGTATATCCAGGCTATAAAT pLKO_005 4405 3UTR 100% 15.000 9.000 N Ppfia1 n/a
14 TRCN0000342548 ATGTATATCCAGGCTATAAAT pLKO_005 4405 3UTR 100% 15.000 9.000 N PPFIA1 n/a
15 TRCN0000380944 CAGAGATCCAGCGTGAGATTG pLKO_005 3200 CDS 100% 10.800 6.480 N PPFIA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006718716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07248 pDONR223 100% 91.8% 91.8% None (many diffs) n/a
2 ccsbBroad304_07248 pLX_304 0% 91.8% 91.8% V5 (many diffs) n/a
3 TRCN0000492109 GCCTACGAGACGTCTGAGGCGCCA pLX_317 9.8% 91.8% 91.8% V5 (many diffs) n/a
Download CSV