Transcript: Human XM_006719391.4

PREDICTED: Homo sapiens ADP ribosylation factor 3 (ARF3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARF3 (377)
Length:
1771
CDS:
311..724

Additional Resources:

NCBI RefSeq record:
XM_006719391.4
NBCI Gene record:
ARF3 (377)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719391.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420824 CAATGATCGGGAGCGAGTAAA pLKO_005 592 CDS 100% 13.200 18.480 N ARF3 n/a
2 TRCN0000047676 GAACACCCAAGGGTTGATATT pLKO.1 559 CDS 100% 13.200 9.240 N ARF3 n/a
3 TRCN0000047677 CAAGAGCCTGATTGGGAAGAA pLKO.1 337 CDS 100% 4.950 3.465 N ARF3 n/a
4 TRCN0000047675 CATCCCTACCATTGGGTTCAA pLKO.1 445 CDS 100% 4.950 3.465 N ARF3 n/a
5 TRCN0000047674 GATGCTGTACTCCTTGTCTTT pLKO.1 662 CDS 100% 4.950 3.465 N ARF3 n/a
6 TRCN0000433130 TGATATTTGTGGTCGACAGCA pLKO_005 573 CDS 100% 2.640 1.848 N ARF3 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1134 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1134 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719391.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00095 pDONR223 100% 74.2% 70.7% None (many diffs) n/a
2 ccsbBroad304_00095 pLX_304 0% 74.2% 70.7% V5 (many diffs) n/a
3 TRCN0000467892 AAGACCTTCCAAGGGGGGATCTAG pLX_317 85.4% 74.2% 70.7% V5 (many diffs) n/a
4 ccsbBroadEn_00094 pDONR223 100% 63.1% 68.5% None (many diffs) n/a
5 ccsbBroad304_00094 pLX_304 0% 63.1% 68.5% V5 (many diffs) n/a
6 TRCN0000470051 AGACATCCAACAGCAAGTTGGGTG pLX_317 77.4% 63.1% 68.5% V5 (many diffs) n/a
Download CSV