Transcript: Human XM_006719588.4

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 12 (MAP3K12), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K12 (7786)
Length:
4849
CDS:
658..3336

Additional Resources:

NCBI RefSeq record:
XM_006719588.4
NBCI Gene record:
MAP3K12 (7786)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719588.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231658 ACTCGTATTCCTTGTACATAG pLKO_005 3342 3UTR 100% 10.800 15.120 N MAP3K12 n/a
2 TRCN0000231655 CCACGAAATCGCCCATCATTC pLKO_005 1807 CDS 100% 10.800 15.120 N MAP3K12 n/a
3 TRCN0000322150 CCACGAAATCGCCCATCATTC pLKO_005 1807 CDS 100% 10.800 15.120 N Map3k12 n/a
4 TRCN0000231654 GGAATAGCAAACCACGAAATC pLKO_005 1796 CDS 100% 10.800 15.120 N MAP3K12 n/a
5 TRCN0000367562 TCAGGCGAGAGCAAGCTTTAG pLKO_005 2129 CDS 100% 10.800 15.120 N MAP3K12 n/a
6 TRCN0000231657 TCCATGAAAGCCACTCGTATT pLKO_005 3330 CDS 100% 10.800 15.120 N MAP3K12 n/a
7 TRCN0000367621 GACATCAAGCACTTGCGAAAG pLKO_005 1237 CDS 100% 6.000 8.400 N MAP3K12 n/a
8 TRCN0000367534 ACATGCGCCAGTCACTATCTA pLKO_005 2984 CDS 100% 5.625 7.875 N MAP3K12 n/a
9 TRCN0000001000 CCTCAAAGAAACCGACATCAA pLKO.1 1224 CDS 100% 4.950 6.930 N MAP3K12 n/a
10 TRCN0000001002 CTACGACGATGTGGTGAAGAT pLKO.1 1491 CDS 100% 4.950 6.930 N MAP3K12 n/a
11 TRCN0000001003 AGAAACCGACATCAAGCACTT pLKO.1 1230 CDS 100% 4.050 5.670 N MAP3K12 n/a
12 TRCN0000345133 ACCTGCACCTGCACAAGATTA pLKO_005 1433 CDS 100% 13.200 9.240 N Map3k12 n/a
13 TRCN0000367594 ACCTGCACCTGCACAAGATTA pLKO_005 1433 CDS 100% 13.200 9.240 N MAP3K12 n/a
14 TRCN0000356124 CAACCTGTATATGGAACTTAA pLKO_005 2067 CDS 100% 13.200 9.240 N MAP3K12 n/a
15 TRCN0000367575 TGTGGTGAAGATCTCAGATTT pLKO_005 1500 CDS 100% 13.200 9.240 N MAP3K12 n/a
16 TRCN0000367556 CAAGTCACCCAACATGCTAAT pLKO_005 1467 CDS 100% 10.800 7.560 N MAP3K12 n/a
17 TRCN0000367516 TGGACATCAGGGAGCACTATG pLKO_005 2024 CDS 100% 10.800 7.560 N MAP3K12 n/a
18 TRCN0000199035 CCTGAGGTGATCCGCAATGAA pLKO.1 1591 CDS 100% 5.625 3.938 N MAP3K12 n/a
19 TRCN0000000999 GCGCCACATAATCAACAGAAA pLKO.1 3410 3UTR 100% 4.950 3.465 N MAP3K12 n/a
20 TRCN0000001001 CAGGGAGCACTATGAAAGGAA pLKO.1 2031 CDS 100% 3.000 2.100 N MAP3K12 n/a
21 TRCN0000197106 GCACTGAATTGGACAACTCCA pLKO.1 3272 CDS 100% 2.640 1.848 N MAP3K12 n/a
22 TRCN0000231656 ATCCTCAAGACGGAGTCTTTG pLKO_005 2278 CDS 100% 10.800 6.480 N MAP3K12 n/a
23 TRCN0000022570 CCTAAACTAGATGCAGCCCTA pLKO.1 2302 CDS 100% 2.160 3.024 N Map3k12 n/a
24 TRCN0000022572 CCCATCATTCCGACAGATCTT pLKO.1 1818 CDS 100% 4.950 3.465 N Map3k12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719588.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491519 CTTACGAAATCTTTTTAATGGCCG pLX_317 15.3% 74.9% 74.7% V5 (not translated due to prior stop codon) 138_236del;2103_2109delAGTAGGG;2113_2676delinsC n/a
2 ccsbBroadEn_14884 pDONR223 0% 59.3% 57.9% None (many diffs) n/a
3 ccsbBroad304_14884 pLX_304 0% 59.3% 57.9% V5 (many diffs) n/a
4 TRCN0000472349 TTCTTGGTCAAGTATAGATATGCC pLX_317 20.8% 59.3% 57.9% V5 (many diffs) n/a
5 TRCN0000466223 ACCATACTTGTCTATGTCGTCGGC pLX_317 20.8% 59.3% 57.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_13986 pDONR223 100% 59.3% 57.6% None (many diffs) n/a
7 ccsbBroad304_13986 pLX_304 0% 59.3% 57.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV