Transcript: Human XM_006719639.2

PREDICTED: Homo sapiens coenzyme Q5, methyltransferase (COQ5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COQ5 (84274)
Length:
1609
CDS:
364..1104

Additional Resources:

NCBI RefSeq record:
XM_006719639.2
NBCI Gene record:
COQ5 (84274)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719639.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160953 GTCTTGGTATCCATCGTGTTT pLKO.1 380 CDS 100% 4.950 6.930 N COQ5 n/a
2 TRCN0000161988 GCCTTGGACTCATGTTTGAAT pLKO.1 1215 3UTR 100% 5.625 4.500 N COQ5 n/a
3 TRCN0000162460 CGAAAGTCTAACATCAGGCAT pLKO.1 1053 CDS 100% 2.640 2.112 N COQ5 n/a
4 TRCN0000163240 GATCCGGAATGTCACACACAT pLKO.1 774 CDS 100% 4.950 3.465 N COQ5 n/a
5 TRCN0000159682 GATATTTACACCATTGCCTTT pLKO.1 751 CDS 100% 4.050 2.835 N COQ5 n/a
6 TRCN0000163981 CCAGAGGCATTTGGTCTGTAT pLKO.1 1312 3UTR 100% 4.950 2.970 N COQ5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719639.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09171 pDONR223 100% 75.2% 75.2% None 0_1ins243 n/a
2 ccsbBroad304_09171 pLX_304 0% 75.2% 75.2% V5 0_1ins243 n/a
3 TRCN0000481164 ATTACCTTTGTGAACAGCTCCAAC pLX_317 44% 75.2% 75.2% V5 0_1ins243 n/a
Download CSV