Transcript: Human XM_006719682.2

PREDICTED: Homo sapiens ubiquitin protein ligase E3B (UBE3B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBE3B (89910)
Length:
6597
CDS:
828..3959

Additional Resources:

NCBI RefSeq record:
XM_006719682.2
NBCI Gene record:
UBE3B (89910)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004775 GCTCGGTTCCTTTGAAGATTT pLKO.1 6187 3UTR 100% 13.200 9.240 N UBE3B n/a
2 TRCN0000342245 GCTCGGTTCCTTTGAAGATTT pLKO_005 6187 3UTR 100% 13.200 9.240 N UBE3B n/a
3 TRCN0000004777 CCCAGTGAAGAGTCTCCTAAA pLKO.1 2099 CDS 100% 10.800 7.560 N UBE3B n/a
4 TRCN0000342314 CCCAGTGAAGAGTCTCCTAAA pLKO_005 2099 CDS 100% 10.800 7.560 N UBE3B n/a
5 TRCN0000004776 CCGTGATGTATGTGAAAGTTT pLKO.1 1718 CDS 100% 5.625 3.938 N UBE3B n/a
6 TRCN0000342313 CCGTGATGTATGTGAAAGTTT pLKO_005 1718 CDS 100% 5.625 3.938 N UBE3B n/a
7 TRCN0000004778 CGTGCCATTTGCATCCTTCTT pLKO.1 3206 CDS 100% 4.950 3.465 N UBE3B n/a
8 TRCN0000004779 GCTGGTCACTATCTCCTCTTT pLKO.1 2504 CDS 100% 4.950 3.465 N UBE3B n/a
9 TRCN0000342315 GCTGGTCACTATCTCCTCTTT pLKO_005 2504 CDS 100% 4.950 3.465 N UBE3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09284 pDONR223 100% 95.5% 94% None (many diffs) n/a
2 ccsbBroad304_09284 pLX_304 0% 95.5% 94% V5 (many diffs) n/a
3 TRCN0000479398 ACTATTTAACACCTTAATACCCGG pLX_317 10.2% 95.5% 94% V5 (many diffs) n/a
4 ccsbBroadEn_12928 pDONR223 100% 22.1% 19.7% None (many diffs) n/a
5 ccsbBroad304_12928 pLX_304 0% 22.1% 19.7% V5 (many diffs) n/a
6 TRCN0000469138 CGTAGCACTGTTAGGAGCTACTCA pLX_317 57.5% 22.1% 19.7% V5 (many diffs) n/a
Download CSV