Transcript: Human XM_006719706.2

PREDICTED: Homo sapiens kinetochore associated 1 (KNTC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KNTC1 (9735)
Length:
6956
CDS:
146..6775

Additional Resources:

NCBI RefSeq record:
XM_006719706.2
NBCI Gene record:
KNTC1 (9735)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719706.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130659 CCTCCCGTGGATCTAGAATAT pLKO.1 4844 CDS 100% 13.200 18.480 N KNTC1 n/a
2 TRCN0000303588 CTTAGTGGATTATCGTAAATC pLKO_005 6758 CDS 100% 13.200 18.480 N KNTC1 n/a
3 TRCN0000303589 TCTGACACGGACCTCATATTT pLKO_005 2516 CDS 100% 15.000 12.000 N KNTC1 n/a
4 TRCN0000117935 CGTGCTGAGTTTATGGGATAT pLKO.1 964 CDS 100% 10.800 8.640 N KNTC1 n/a
5 TRCN0000117932 GCTGAGTTTATGGGATATTTA pLKO.1 967 CDS 100% 15.000 10.500 N KNTC1 n/a
6 TRCN0000299300 GCTGAGTTTATGGGATATTTA pLKO_005 967 CDS 100% 15.000 10.500 N KNTC1 n/a
7 TRCN0000303590 ATTAGCACAGATACCATATAC pLKO_005 1223 CDS 100% 13.200 9.240 N KNTC1 n/a
8 TRCN0000117936 GCCCTTGAGATGGTTCCTTTA pLKO.1 4637 CDS 100% 10.800 7.560 N KNTC1 n/a
9 TRCN0000299301 GCCCTTGAGATGGTTCCTTTA pLKO_005 4637 CDS 100% 10.800 7.560 N KNTC1 n/a
10 TRCN0000127966 GCCGTGCTCAAGATCATGTAT pLKO.1 2540 CDS 100% 5.625 3.938 N KNTC1 n/a
11 TRCN0000117934 GCCAGGCAGTATATCCAGTTA pLKO.1 6332 CDS 100% 4.950 3.465 N KNTC1 n/a
12 TRCN0000117933 GCGTTTATGTTATCTGATGAT pLKO.1 2801 CDS 100% 4.950 3.465 N KNTC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719706.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14945 pDONR223 66.5% 99.8% 43.5% None (many diffs) n/a
2 ccsbBroad304_14945 pLX_304 0% 99.8% 43.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV