Transcript: Human XM_006720246.3

PREDICTED: Homo sapiens dehydrogenase/reductase 4 like 1 (DHRS4L1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DHRS4L1 (728635)
Length:
1156
CDS:
18..752

Additional Resources:

NCBI RefSeq record:
XM_006720246.3
NBCI Gene record:
DHRS4L1 (728635)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262188 GCCCTAGCCCTAATGATAAAG pLKO_005 345 CDS 100% 13.200 9.240 N DHRS4L1 n/a
2 TRCN0000262186 TCTCTTGGCATCGTGTCTTTC pLKO_005 657 CDS 100% 10.800 7.560 N DHRS4L1 n/a
3 TRCN0000036688 CTCCACCGACTGGATCGGCTT pLKO.1 134 CDS 100% 0.000 0.000 N LOC400197 n/a
4 TRCN0000036687 GCTGAGCATGACGGGCACTGT pLKO.1 257 CDS 100% 0.000 0.000 N LOC400197 n/a
5 TRCN0000372100 TTACTGTTCACCTCATCAAAT pLKO_005 845 3UTR 100% 13.200 6.600 Y DHRS4L2 n/a
6 TRCN0000221920 CCTAGCACCTGGACTTATCAA pLKO.1 542 CDS 100% 5.625 2.813 Y DHRS4 n/a
7 TRCN0000221922 CCTGGCTTCAGTCCTTACAAT pLKO.1 444 CDS 100% 5.625 2.813 Y DHRS4 n/a
8 TRCN0000028101 CCCAAGGAACATTAGGGTGAA pLKO.1 518 CDS 100% 4.050 2.025 Y DHRS4L2 n/a
9 TRCN0000036684 ACAAATAAGGTGGCCCTGGTA pLKO.1 108 CDS 100% 2.640 1.320 Y LOC400197 n/a
10 TRCN0000221923 CATGAAAGAAACCCTGCGGAT pLKO.1 611 CDS 100% 2.160 1.080 Y DHRS4 n/a
11 TRCN0000036685 GCTCACAAATAAGGTGGCCCT pLKO.1 104 CDS 100% 0.540 0.270 Y LOC400197 n/a
12 TRCN0000036686 CAGCAGAATGTGGACCAGGCA pLKO.1 213 CDS 100% 0.220 0.110 Y LOC400197 n/a
13 TRCN0000028066 ACCTTACTGTTCACCTCATAA pLKO.1 842 3UTR 100% 13.200 6.600 Y DHRS4L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14058 pDONR223 100% 81.5% None (many diffs) n/a
2 ccsbBroad304_14058 pLX_304 0% 81.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477836 TGAAGCAGCATCATATTTACTACA pLX_317 50.9% 81.5% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_13573 pDONR223 100% 65.3% 52.8% None (many diffs) n/a
5 ccsbBroad304_13573 pLX_304 0% 65.3% 52.8% V5 (many diffs) n/a
6 TRCN0000475299 CGTCATGAGGTAACATAAGATCTA pLX_317 41.4% 65.3% 52.8% V5 (many diffs) n/a
Download CSV