Transcript: Human XM_006720459.2

PREDICTED: Homo sapiens gamma-aminobutyric acid type A receptor alpha5 subunit (GABRA5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GABRA5 (2558)
Length:
2672
CDS:
315..1703

Additional Resources:

NCBI RefSeq record:
XM_006720459.2
NBCI Gene record:
GABRA5 (2558)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061268 CGGCACTTTCAACTTAGTTTA pLKO.1 1625 CDS 100% 13.200 18.480 N GABRA5 n/a
2 TRCN0000257206 GATGAAAGGCTTCGGTTTAAG pLKO_005 630 CDS 100% 13.200 18.480 N GABRA5 n/a
3 TRCN0000231860 TAGAGTTTGCCACGGTCAATT pLKO_005 1321 CDS 100% 13.200 18.480 N GABRA5 n/a
4 TRCN0000061270 CCGAATCGTATTCCCAGTCTT pLKO.1 1601 CDS 100% 4.950 6.930 N GABRA5 n/a
5 TRCN0000061269 GCGTGAAGTCATACTAAATAA pLKO.1 1409 CDS 100% 15.000 12.000 N GABRA5 n/a
6 TRCN0000231859 ATGACAACATCACGATATTTA pLKO_005 442 CDS 100% 15.000 10.500 N GABRA5 n/a
7 TRCN0000189124 GCAGCTATGCGTACCCTAATT pLKO.1 889 CDS 100% 13.200 9.240 N LOC441742 n/a
8 TRCN0000231862 GCGAGAAACAGAGATCATAAA pLKO_005 2121 3UTR 100% 13.200 9.240 N GABRA5 n/a
9 TRCN0000231861 TGAATAGGGAGCCGGTGATAA pLKO_005 1660 CDS 100% 13.200 9.240 N GABRA5 n/a
10 TRCN0000061271 CACGATATTTACCAGGATCTT pLKO.1 452 CDS 100% 4.950 3.465 N GABRA5 n/a
11 TRCN0000197370 CTGAAGTCGTTTACGTCTGGA pLKO.1 910 CDS 100% 2.640 1.848 N LOC441742 n/a
12 TRCN0000061272 CATGAACTTATCCAGTCACTT pLKO.1 377 CDS 100% 4.950 2.970 N GABRA5 n/a
13 TRCN0000188829 CCCTCTGAAATTTGGCAGCTA pLKO.1 875 CDS 100% 2.640 1.584 N LOC441742 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06241 pDONR223 100% 99.7% 99.5% None 6C>G;606T>C;1381C>T n/a
2 ccsbBroad304_06241 pLX_304 0% 99.7% 99.5% V5 6C>G;606T>C;1381C>T n/a
3 TRCN0000467210 TATTTAGCACGCAAGAGCCGGAAC pLX_317 13.7% 99.7% 99.5% V5 6C>G;606T>C;1381C>T n/a
Download CSV