Transcript: Human XM_006720775.3

PREDICTED: Homo sapiens homer scaffold protein 2 (HOMER2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HOMER2 (9455)
Length:
9320
CDS:
479..1573

Additional Resources:

NCBI RefSeq record:
XM_006720775.3
NBCI Gene record:
HOMER2 (9455)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720775.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116136 CAGCACAATCACACCGAATAT pLKO.1 682 CDS 100% 13.200 18.480 N HOMER2 n/a
2 TRCN0000116133 CAAGTAATCATTCCCAAGAAT pLKO.1 879 CDS 100% 5.625 7.875 N HOMER2 n/a
3 TRCN0000116135 GTCACCGTTTCCTACTTCTAT pLKO.1 602 CDS 100% 5.625 3.938 N HOMER2 n/a
4 TRCN0000116134 GAAGACAAAGTGCGTTCCTTA pLKO.1 1412 CDS 100% 4.950 3.465 N HOMER2 n/a
5 TRCN0000204533 CCTCCCAAAGTGCTGGAATTA pLKO.1 5642 3UTR 100% 13.200 6.600 Y LRRC74B n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6253 3UTR 100% 4.950 2.475 Y ERAP2 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6254 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720775.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487765 TTCTTGTGTCTAGGATACTCTTTC pLX_317 22.6% 94.2% 93.6% V5 1_12del;17_34del;418_450del n/a
2 TRCN0000488563 ACTTACCTTGTCAGGAAGGGAAGC pLX_317 35.3% 94.2% 93.6% V5 (not translated due to prior stop codon) 1_12del;17_34del;418_450del n/a
Download CSV