Transcript: Human XM_006721952.3

PREDICTED: Homo sapiens septin 4 (SEPTIN4), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEPTIN4 (5414)
Length:
1344
CDS:
92..1174

Additional Resources:

NCBI RefSeq record:
XM_006721952.3
NBCI Gene record:
SEPTIN4 (5414)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721952.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164795 CCCTAAAGGAAAGCATCCCAT pLKO.1 747 CDS 100% 2.640 3.696 N SEPTIN4 n/a
2 TRCN0000165287 GTGGACCACAAGAAACGCAAA pLKO.1 632 CDS 100% 4.050 3.240 N SEPTIN4 n/a
3 TRCN0000441026 AGGAACGGAATCGCAACAAAC pLKO_005 999 CDS 100% 10.800 7.560 N Sept4 n/a
4 TRCN0000164742 CATTGTGGACACACCAGGTTT pLKO.1 352 CDS 100% 4.950 3.465 N SEPTIN4 n/a
5 TRCN0000101736 CCTAAAGGAAAGCATCCCATT pLKO.1 748 CDS 100% 4.050 2.835 N Sept4 n/a
6 TRCN0000160749 CCTAAAGGAAAGCATCCCATT pLKO.1 748 CDS 100% 4.050 2.835 N SEPTIN4 n/a
7 TRCN0000165540 GCTGAAGAGAGGATCATGCAA pLKO.1 269 CDS 100% 3.000 2.100 N SEPTIN4 n/a
8 TRCN0000101737 CCGGCCATTGGATGTTGAATT pLKO.1 538 CDS 100% 0.000 0.000 N Sept4 n/a
9 TRCN0000165317 GATGCAGGAGATGCTACACAA pLKO.1 1123 CDS 100% 4.950 2.970 N SEPTIN4 n/a
10 TRCN0000433206 TGCATCAGCGGGTCAACATTG pLKO_005 570 CDS 100% 10.800 7.560 N Sept4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721952.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01233 pDONR223 100% 75.3% 75.1% None 0_1ins346;2_3insTCCTCTGA n/a
2 ccsbBroad304_01233 pLX_304 0% 75.3% 75.1% V5 0_1ins346;2_3insTCCTCTGA n/a
3 TRCN0000481592 ATGCAACTCATTTCAGGTCCTCCG pLX_317 29.2% 67.9% 61.5% V5 (not translated due to prior stop codon) 0_1ins346;2_3insTCCTCTGA;923_924ins155 n/a
4 TRCN0000476347 CCATTTCCAACTATGATTTCGGGC pLX_317 25.8% 67.9% 61.5% V5 (not translated due to prior stop codon) 0_1ins346;2_3insTCCTCTGA;923_924ins155 n/a
Download CSV