Transcript: Human XM_006722025.2

PREDICTED: Homo sapiens Sp2 transcription factor (SP2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SP2 (6668)
Length:
4812
CDS:
261..2243

Additional Resources:

NCBI RefSeq record:
XM_006722025.2
NBCI Gene record:
SP2 (6668)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006722025.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433492 ACCCGATCAAATGCCAATATC pLKO_005 609 CDS 100% 13.200 18.480 N SP2 n/a
2 TRCN0000020471 CGGCAAGAATAGCTTTGGAAT pLKO.1 476 CDS 100% 4.950 6.930 N SP2 n/a
3 TRCN0000424219 GCCCGTCAACAACCTTGTGAA pLKO_005 881 CDS 100% 4.950 6.930 N SP2 n/a
4 TRCN0000424089 ACGTTCCGTAAGACGTCCTTG pLKO_005 1842 CDS 100% 4.050 5.670 N SP2 n/a
5 TRCN0000433640 AGAAGCCCTCCCAGAACTTTC pLKO_005 1246 CDS 100% 10.800 7.560 N SP2 n/a
6 TRCN0000412285 TGGTGTTCGCTATCCAGAATC pLKO_005 568 CDS 100% 10.800 7.560 N SP2 n/a
7 TRCN0000432518 TGTCTAAGACTAACAAGAAAG pLKO_005 958 CDS 100% 10.800 7.560 N SP2 n/a
8 TRCN0000020473 GCAGAATGTTTCTGGGAACAA pLKO.1 1631 CDS 100% 4.950 3.465 N SP2 n/a
9 TRCN0000020472 GCAGGAAATAACCTGCTCATT pLKO.1 1077 CDS 100% 0.495 0.347 N SP2 n/a
10 TRCN0000433541 TCAGATTCAGGCAAGCAATTC pLKO_005 647 CDS 100% 10.800 6.480 N SP2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3621 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006722025.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11151 pDONR223 100% 90.9% 91% None 586C>T;636T>C;1804_1980del n/a
2 ccsbBroad304_11151 pLX_304 0% 90.9% 91% V5 586C>T;636T>C;1804_1980del n/a
3 TRCN0000473389 CATTGGAGCGGCCCTTCAGACTAA pLX_317 24.4% 90.9% 91% V5 586C>T;636T>C;1804_1980del n/a
4 ccsbBroadEn_11150 pDONR223 100% 36.3% 35.1% None (many diffs) n/a
5 ccsbBroad304_11150 pLX_304 0% 36.3% 35.1% V5 (many diffs) n/a
6 TRCN0000465245 CACGAATGCACACACAACGACCCG pLX_317 42.6% 36.3% 35.1% V5 (many diffs) n/a
Download CSV