Transcript: Human XM_006724173.2

PREDICTED: Homo sapiens pescadillo ribosomal biogenesis factor 1 (PES1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PES1 (23481)
Length:
2262
CDS:
78..1841

Additional Resources:

NCBI RefSeq record:
XM_006724173.2
NBCI Gene record:
PES1 (23481)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724173.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117726 CACATCATCAAGGAACGGTAT pLKO.1 429 CDS 100% 4.050 5.670 N PES1 n/a
2 TRCN0000300708 CACATCATCAAGGAACGGTAT pLKO_005 429 CDS 100% 4.050 5.670 N PES1 n/a
3 TRCN0000117722 AGTCACTTCTCCTCCTCCTTT pLKO.1 1931 3UTR 100% 4.950 3.465 N PES1 n/a
4 TRCN0000300648 AGTCACTTCTCCTCCTCCTTT pLKO_005 1931 3UTR 100% 4.950 3.465 N PES1 n/a
5 TRCN0000117724 CTTATCAAAGACATCAGGTTT pLKO.1 273 CDS 100% 4.950 3.465 N PES1 n/a
6 TRCN0000300706 CTTATCAAAGACATCAGGTTT pLKO_005 273 CDS 100% 4.950 3.465 N PES1 n/a
7 TRCN0000117725 GCTTTGTCAACTTCCGCCTTT pLKO.1 772 CDS 100% 4.050 2.835 N PES1 n/a
8 TRCN0000117723 CCAGAAGATCATGTTTGGCAA pLKO.1 1718 CDS 100% 2.640 1.848 N PES1 n/a
9 TRCN0000300707 CCAGAAGATCATGTTTGGCAA pLKO_005 1718 CDS 100% 2.640 1.848 N PES1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724173.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02777 pDONR223 100% 99.8% 99.8% None 1517_1518insGAA n/a
2 ccsbBroad304_02777 pLX_304 0% 99.8% 99.8% V5 1517_1518insGAA n/a
3 TRCN0000474494 GCTGCTAACCAGGACTGGCGTCTT pLX_317 23.2% 99.8% 99.8% V5 1517_1518insGAA n/a
Download CSV